Transcript: Human NM_015529.4

Homo sapiens monooxygenase DBH like 1 (MOXD1), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
MOXD1 (26002)
Length:
2989
CDS:
50..1891

Additional Resources:

NCBI RefSeq record:
NM_015529.4
NBCI Gene record:
MOXD1 (26002)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015529.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303417 TCATTTGAAGTACAGGTTAAA pLKO_005 1938 3UTR 100% 13.200 18.480 N MOXD1 n/a
2 TRCN0000078176 GCGGTTATTGAATCCTGAGAA pLKO.1 556 CDS 100% 4.950 3.960 N MOXD1 n/a
3 TRCN0000292095 GCGGTTATTGAATCCTGAGAA pLKO_005 556 CDS 100% 4.950 3.960 N MOXD1 n/a
4 TRCN0000303415 GCCCTACCTCCAGGATTATTT pLKO_005 301 CDS 100% 15.000 10.500 N MOXD1 n/a
5 TRCN0000078173 CCACTCTGGTTCCCTTGTTTA pLKO.1 2447 3UTR 100% 13.200 9.240 N MOXD1 n/a
6 TRCN0000303416 CCATACTTTGATCTGGTAAAT pLKO_005 602 CDS 100% 13.200 9.240 N MOXD1 n/a
7 TRCN0000078174 CCGCATTATGTGCTCCTAGAA pLKO.1 944 CDS 100% 4.950 3.465 N MOXD1 n/a
8 TRCN0000292096 CCGCATTATGTGCTCCTAGAA pLKO_005 944 CDS 100% 4.950 3.465 N MOXD1 n/a
9 TRCN0000078175 CCAGATATAGAAAGACCCTAT pLKO.1 1751 CDS 100% 4.050 2.835 N MOXD1 n/a
10 TRCN0000078177 CAGATATAGAAAGACCCTATA pLKO.1 1752 CDS 100% 1.080 0.756 N MOXD1 n/a
11 TRCN0000076330 GCCAAATGTTTAAGATTCCTA pLKO.1 663 CDS 100% 3.000 2.100 N Moxd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015529.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07977 pDONR223 100% 99.9% 99.8% None 1615A>G n/a
2 ccsbBroad304_07977 pLX_304 0% 99.9% 99.8% V5 1615A>G n/a
3 TRCN0000480275 CTGGGCCATTTGGAACTCTTTCAC pLX_317 19.7% 99.9% 99.8% V5 1615A>G n/a
4 TRCN0000488119 TAGTATTCGCCAATATCTCACGGC pLX_317 18.1% 88.6% 88.5% V5 1_207del;1839_1840insG n/a
5 TRCN0000488239 CGGAGTATGCGCATCATACGGTCA pLX_317 20.7% 88.3% 88.7% V5 (not translated due to prior stop codon) 1_207del;1839_1840insTGAAAGCT n/a
6 TRCN0000489203 ATGACCTGAACTTTTTACAACGAC pLX_317 18% 87.2% 85.2% V5 (many diffs) n/a
7 TRCN0000488014 ACAACGACTACCCACGCTATACGT pLX_317 18.1% 87% 86.3% V5 (many diffs) n/a
8 TRCN0000491296 ATTTTACAGAAATCAACTCCATAG pLX_317 16.5% 86.9% 85.4% V5 (not translated due to prior stop codon) (many diffs) n/a
9 TRCN0000488858 ACGGATAGACCCTACTCCGCACTC pLX_317 20.6% 86.7% 86.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV