Transcript: Mouse NM_033583.3

Mus musculus protocadherin gamma subfamily C, 5 (Pcdhgc5), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Pcdhgc5 (93708)
Length:
4708
CDS:
130..2964

Additional Resources:

NCBI RefSeq record:
NM_033583.3
NBCI Gene record:
Pcdhgc5 (93708)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_033583.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094751 GCTGAACATTTCAGACGTTAA pLKO.1 1452 CDS 100% 10.800 7.560 N Pcdhgc5 n/a
2 TRCN0000094753 CCACTTCTCTCTGCATGTGAA pLKO.1 657 CDS 100% 4.950 3.465 N Pcdhgc5 n/a
3 TRCN0000094750 CGGACCTTTGACTATGAGTTA pLKO.1 1687 CDS 100% 4.950 3.465 N Pcdhgc5 n/a
4 TRCN0000094752 CTTCACTTTCATGTCAGCTAA pLKO.1 2253 CDS 100% 4.950 3.465 N Pcdhgc5 n/a
5 TRCN0000094239 CCCTGTACTGACTTCTCTATA pLKO.1 4555 3UTR 100% 13.200 6.600 Y Pcdhga10 n/a
6 TRCN0000094839 CCTGTACTGACTTCTCTATAA pLKO.1 4556 3UTR 100% 13.200 6.600 Y Pcdhga11 n/a
7 TRCN0000094814 GACGACTTCTAAGTGAGTTTA pLKO.1 3994 3UTR 100% 13.200 6.600 Y Pcdhgb6 n/a
8 TRCN0000094199 GCTGGTGTAGAATAGCCAATA pLKO.1 4393 3UTR 100% 10.800 5.400 Y Pcdhgb4 n/a
9 TRCN0000094769 CCTATTCAATCAGTGATTGTA pLKO.1 3186 3UTR 100% 5.625 2.813 Y Pcdhgc4 n/a
10 TRCN0000094989 CCTTACCAGGTGCCATTTCTT pLKO.1 4237 3UTR 100% 5.625 2.813 Y Pcdhga8 n/a
11 TRCN0000094369 CGGTAGGGAGAGTATTACAAT pLKO.1 3446 3UTR 100% 5.625 2.813 Y Pcdhga12 n/a
12 TRCN0000094684 CAATGGATTTAAGCTGACATT pLKO.1 3961 3UTR 100% 4.950 2.475 Y Pcdhga5 n/a
13 TRCN0000094289 CCAATGGATTTAAGCTGACAT pLKO.1 3960 3UTR 100% 4.950 2.475 Y Pcdhga9 n/a
14 TRCN0000094319 CCTAGCCCTTACAGTAGTGTA pLKO.1 4355 3UTR 100% 4.950 2.475 Y Pcdhgb1 n/a
15 TRCN0000094649 CCTCAAAGAAGAGACTCCTTT pLKO.1 3716 3UTR 100% 4.950 2.475 Y Pcdhga1 n/a
16 TRCN0000094049 CCTCTCCTTCAGTTCAGCTTT pLKO.1 3474 3UTR 100% 4.950 2.475 Y Pcdhgb5 n/a
17 TRCN0000095019 CCTTACAGTAGTGTAGAAGAT pLKO.1 4361 3UTR 100% 4.950 2.475 Y Pcdhga4 n/a
18 TRCN0000094104 CGACGACTTCTAAGTGAGTTT pLKO.1 3993 3UTR 100% 4.950 2.475 Y Pcdhga2 n/a
19 TRCN0000094504 CGTCTGTCCTTTGAATCTCAA pLKO.1 4476 3UTR 100% 4.950 2.475 Y Pcdhga3 n/a
20 TRCN0000094724 GCCTCCTTGTGCATAGAACTT pLKO.1 4327 3UTR 100% 4.950 2.475 Y Pcdhgb7 n/a
21 TRCN0000094919 GTGGTAAACTAAAGGGAAGTT pLKO.1 3759 3UTR 100% 4.950 2.475 Y Pcdhgb8 n/a
22 TRCN0000094374 CGCTGGTGTAGAATAGCCAAT pLKO.1 4392 3UTR 100% 4.050 2.025 Y Pcdhgc3 n/a
23 TRCN0000334198 CGCTGGTGTAGAATAGCCAAT pLKO_005 4392 3UTR 100% 4.050 2.025 Y Pcdhgc3 n/a
24 TRCN0000094509 CCTCTGGTACTGATGATGCTT pLKO.1 3582 3UTR 100% 3.000 1.500 Y Pcdhgb2 n/a
25 TRCN0000095024 GCCTGTTAATAGGGTCTTGCA pLKO.1 3820 3UTR 100% 2.640 1.320 Y Pcdhga6 n/a
26 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3243 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033583.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08618 pDONR223 100% 78.7% 79.7% None (many diffs) n/a
2 ccsbBroad304_08618 pLX_304 0% 78.7% 79.7% V5 (many diffs) n/a
3 TRCN0000480418 TCGCTGACGTCATCCAGGTAATAT pLX_317 14.6% 78.7% 79.7% V5 (many diffs) n/a
4 ccsbBroadEn_01151 pDONR223 100% 12.8% 13.5% None (many diffs) n/a
5 ccsbBroad304_01151 pLX_304 0% 12.8% 13.5% V5 (many diffs) n/a
6 TRCN0000466539 CATGGTTCGGTAATGAAAGTTCCA pLX_317 36.4% 12.8% 13.5% V5 (many diffs) n/a
7 ccsbBroadEn_11019 pDONR223 100% 5.7% 6.3% None (many diffs) n/a
8 ccsbBroad304_11019 pLX_304 0% 5.7% 6.3% V5 (many diffs) n/a
Download CSV