Transcript: Mouse NM_033593.3

Mus musculus protocadherin gamma subfamily A, 10 (Pcdhga10), mRNA.

Source:
NCBI, updated 2015-07-31
Taxon:
Mus musculus (mouse)
Gene:
Pcdhga10 (93722)
Length:
4534
CDS:
1..2793

Additional Resources:

NCBI RefSeq record:
NM_033593.3
NBCI Gene record:
Pcdhga10 (93722)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_033593.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424814 AGTCCATTGACAATTACTATA pLKO_005 1181 CDS 100% 13.200 18.480 N Pcdhga10 n/a
2 TRCN0000094241 CCCGCTTACAACATCACAGTA pLKO.1 1240 CDS 100% 4.950 6.930 N Pcdhga10 n/a
3 TRCN0000094242 GCCCTACTAAACGTCCATGAT pLKO.1 1093 CDS 100% 4.950 6.930 N Pcdhga10 n/a
4 TRCN0000094240 CGCCACTTTCTTCCTACATAT pLKO.1 1490 CDS 100% 13.200 10.560 N Pcdhga10 n/a
5 TRCN0000413515 ATGTGTCGTTGACTCTGTTTG pLKO_005 1628 CDS 100% 10.800 7.560 N Pcdhga10 n/a
6 TRCN0000414885 GACCTATTCGCACGAGGTTTC pLKO_005 2247 CDS 100% 6.000 4.200 N Pcdhga10 n/a
7 TRCN0000094243 GCAGTCTTCGAGAGATGGATT pLKO.1 2169 CDS 100% 4.950 3.465 N Pcdhga10 n/a
8 TRCN0000094239 CCCTGTACTGACTTCTCTATA pLKO.1 4384 3UTR 100% 13.200 6.600 Y Pcdhga10 n/a
9 TRCN0000094839 CCTGTACTGACTTCTCTATAA pLKO.1 4385 3UTR 100% 13.200 6.600 Y Pcdhga11 n/a
10 TRCN0000094814 GACGACTTCTAAGTGAGTTTA pLKO.1 3823 3UTR 100% 13.200 6.600 Y Pcdhgb6 n/a
11 TRCN0000094199 GCTGGTGTAGAATAGCCAATA pLKO.1 4222 3UTR 100% 10.800 5.400 Y Pcdhgb4 n/a
12 TRCN0000094769 CCTATTCAATCAGTGATTGTA pLKO.1 3015 3UTR 100% 5.625 2.813 Y Pcdhgc4 n/a
13 TRCN0000094989 CCTTACCAGGTGCCATTTCTT pLKO.1 4066 3UTR 100% 5.625 2.813 Y Pcdhga8 n/a
14 TRCN0000094369 CGGTAGGGAGAGTATTACAAT pLKO.1 3275 3UTR 100% 5.625 2.813 Y Pcdhga12 n/a
15 TRCN0000094684 CAATGGATTTAAGCTGACATT pLKO.1 3790 3UTR 100% 4.950 2.475 Y Pcdhga5 n/a
16 TRCN0000094289 CCAATGGATTTAAGCTGACAT pLKO.1 3789 3UTR 100% 4.950 2.475 Y Pcdhga9 n/a
17 TRCN0000094319 CCTAGCCCTTACAGTAGTGTA pLKO.1 4184 3UTR 100% 4.950 2.475 Y Pcdhgb1 n/a
18 TRCN0000094649 CCTCAAAGAAGAGACTCCTTT pLKO.1 3545 3UTR 100% 4.950 2.475 Y Pcdhga1 n/a
19 TRCN0000094049 CCTCTCCTTCAGTTCAGCTTT pLKO.1 3303 3UTR 100% 4.950 2.475 Y Pcdhgb5 n/a
20 TRCN0000095019 CCTTACAGTAGTGTAGAAGAT pLKO.1 4190 3UTR 100% 4.950 2.475 Y Pcdhga4 n/a
21 TRCN0000094104 CGACGACTTCTAAGTGAGTTT pLKO.1 3822 3UTR 100% 4.950 2.475 Y Pcdhga2 n/a
22 TRCN0000094504 CGTCTGTCCTTTGAATCTCAA pLKO.1 4305 3UTR 100% 4.950 2.475 Y Pcdhga3 n/a
23 TRCN0000094724 GCCTCCTTGTGCATAGAACTT pLKO.1 4156 3UTR 100% 4.950 2.475 Y Pcdhgb7 n/a
24 TRCN0000094919 GTGGTAAACTAAAGGGAAGTT pLKO.1 3588 3UTR 100% 4.950 2.475 Y Pcdhgb8 n/a
25 TRCN0000094374 CGCTGGTGTAGAATAGCCAAT pLKO.1 4221 3UTR 100% 4.050 2.025 Y Pcdhgc3 n/a
26 TRCN0000334198 CGCTGGTGTAGAATAGCCAAT pLKO_005 4221 3UTR 100% 4.050 2.025 Y Pcdhgc3 n/a
27 TRCN0000094509 CCTCTGGTACTGATGATGCTT pLKO.1 3411 3UTR 100% 3.000 1.500 Y Pcdhgb2 n/a
28 TRCN0000095024 GCCTGTTAATAGGGTCTTGCA pLKO.1 3649 3UTR 100% 2.640 1.320 Y Pcdhga6 n/a
29 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3072 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033593.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01151 pDONR223 100% 12.9% 13.3% None (many diffs) n/a
2 ccsbBroad304_01151 pLX_304 0% 12.9% 13.3% V5 (many diffs) n/a
3 TRCN0000466539 CATGGTTCGGTAATGAAAGTTCCA pLX_317 36.4% 12.9% 13.3% V5 (many diffs) n/a
4 ccsbBroadEn_11019 pDONR223 100% 5.8% 6.4% None (many diffs) n/a
5 ccsbBroad304_11019 pLX_304 0% 5.8% 6.4% V5 (many diffs) n/a
Download CSV