Transcript: Human NM_145326.3

Homo sapiens zinc finger protein 493 (ZNF493), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
ZNF493 (284443)
Length:
1693
CDS:
106..417

Additional Resources:

NCBI RefSeq record:
NM_145326.3
NBCI Gene record:
ZNF493 (284443)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_145326.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000018498 GAAGGGACACAGTACGGTAGT pLKO.1 330 CDS 100% 4.050 2.835 N ZNF493 n/a
2 TRCN0000018500 CAGCAGGATTTGTATAGGAAA pLKO.1 205 CDS 100% 4.950 2.970 N ZNF493 n/a
3 TRCN0000018499 CTGGTCTTCTTGGCAGGTATT pLKO.1 250 CDS 100% 10.800 5.400 Y ZNF493 n/a
4 TRCN0000419715 TGGTCTTCTTGGCAGGTATTG pLKO_005 251 CDS 100% 10.800 5.400 Y ZNF430 n/a
5 TRCN0000018502 GATGTTAGAGAACTACAGAAA pLKO.1 228 CDS 100% 4.950 2.475 Y ZNF493 n/a
6 TRCN0000018501 GCCGTTGACATTTAGGGATGT pLKO.1 138 CDS 100% 4.050 2.025 Y ZNF493 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145326.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11384 pDONR223 100% 76.6% 69.5% None (many diffs) n/a
2 ccsbBroad304_11384 pLX_304 0% 76.6% 69.5% V5 (many diffs) n/a
3 TRCN0000470576 TACATACAGACCTACACGTAGACC pLX_317 100% 76.6% 69.5% V5 (many diffs) n/a
4 ccsbBroadEn_15729 pDONR223 0% 65.7% 62.1% None (many diffs) n/a
5 ccsbBroad304_15729 pLX_304 0% 65.7% 62.1% V5 (many diffs) n/a
6 TRCN0000470492 GCCGACTTGCTCCATGATGCAGCT pLX_317 100% 65.7% 62.1% V5 (many diffs) n/a
7 ccsbBroadEn_13746 pDONR223 100% 64.9% 57.2% None (many diffs) n/a
8 ccsbBroad304_13746 pLX_304 0% 64.9% 57.2% V5 (many diffs) n/a
9 TRCN0000475669 ATTCGCAGCGAGTTTGTCCGCCGC pLX_317 100% 64.9% 57.2% V5 (many diffs) n/a
10 ccsbBroadEn_10299 pDONR223 100% 64.6% 51.7% None (many diffs) n/a
11 ccsbBroad304_10299 pLX_304 0% 64.6% 51.7% V5 (many diffs) n/a
12 TRCN0000470427 ATGCTGATTAAATGGTCGTCTGCC pLX_317 95.5% 64.6% 51.7% V5 (many diffs) n/a
13 ccsbBroadEn_11549 pDONR223 100% 38% 34.9% None (many diffs) n/a
14 ccsbBroad304_11549 pLX_304 94.6% 38% 34.9% V5 (many diffs) n/a
15 TRCN0000468281 AACATTAGGAAAGAACCCCCACCC pLX_317 100% 38% 34.9% V5 (many diffs) n/a
16 TRCN0000472761 GCGGTTCAATGTTGTAGTCTTGTG pLX_317 63.8% 32.7% 27.1% V5 (not translated due to frame shift) (many diffs) n/a
17 ccsbBroadEn_15273 pDONR223 50.9% 16% 13.3% None (many diffs) n/a
18 ccsbBroad304_15273 pLX_304 0% 16% 13.3% V5 (many diffs) n/a
19 ccsbBroadEn_10024 pDONR223 100% 16% 14% None (many diffs) n/a
20 ccsbBroad304_10024 pLX_304 0% 16% 14% V5 (many diffs) n/a
21 TRCN0000466950 AAAAATGGGCGCTCTGAGACACAC pLX_317 21.1% 16% 14% V5 (many diffs) n/a
22 ccsbBroadEn_13028 pDONR223 100% 8.1% 6.4% None (many diffs) n/a
23 ccsbBroad304_13028 pLX_304 0% 8.1% 6.4% V5 (many diffs) n/a
24 TRCN0000468257 GTACACCAGACCACTACATGCGAC pLX_317 25.6% 8.1% 6.4% V5 (many diffs) n/a
Download CSV