Transcript: Human NM_172078.3

Homo sapiens calcium/calmodulin dependent protein kinase II beta (CAMK2B), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
CAMK2B (816)
Length:
4173
CDS:
174..1802

Additional Resources:

NCBI RefSeq record:
NM_172078.3
NBCI Gene record:
CAMK2B (816)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_172078.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219642 TACCAGCTCTACGAGGATATT pLKO.1 213 CDS 100% 0.000 0.000 N CAMK2B n/a
2 TRCN0000000466 GACCAGATGTGATTTGTTAAA pLKO.1 1935 3UTR 100% 13.200 10.560 N CAMK2B n/a
3 TRCN0000195670 CCGGAAGCAGGAGATCATTAA pLKO.1 1400 CDS 100% 13.200 9.240 N CAMK2B n/a
4 TRCN0000219643 ATAGAGGATGAAGACGCTAAA pLKO.1 1377 CDS 100% 10.800 7.560 N CAMK2B n/a
5 TRCN0000000468 CTCAAACCACCGTCATCCATA pLKO.1 1309 CDS 100% 4.950 3.465 N CAMK2B n/a
6 TRCN0000000467 GATCATTAAGACCACGGAGCA pLKO.1 1412 CDS 100% 2.160 1.512 N CAMK2B n/a
7 TRCN0000199243 CCTGAGGTCCTTCGCAAAGAG pLKO.1 720 CDS 100% 1.650 1.155 N CAMK2B n/a
8 TRCN0000199539 CGCATGTTTGTGTCTGCCTCG pLKO.1 1878 3UTR 100% 0.400 0.280 N CAMK2B n/a
9 TRCN0000000469 ACAAGAAAGCAGATGGAGTCA pLKO.1 1210 CDS 100% 2.640 1.584 N CAMK2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172078.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488486 GACCTCCTCAAGAGGCAACGCTGC pLX_317 10.9% 100% 100% V5 (not translated due to prior stop codon) n/a
2 TRCN0000489411 AAGTGGCATAGCCCCCTCAAGCTG pLX_317 20.6% 99.9% 99.8% V5 1626_1627insG n/a
3 ccsbBroadEn_14563 pDONR223 93.6% 92.7% 92.6% None 947_1019delinsC;1131_1175del n/a
4 ccsbBroad304_14563 pLX_304 0% 92.7% 92.6% V5 947_1019delinsC;1131_1175del n/a
5 TRCN0000468031 AGCATTTCATGGTGGACCTTTAGT pLX_317 28.9% 89% 88.9% V5 (not translated due to frame shift) (many diffs) n/a
6 ccsbBroadEn_14564 pDONR223 0% 92.7% 92.6% None 947_1019delinsC;1131_1175del n/a
7 ccsbBroad304_14564 pLX_304 0% 92.7% 92.6% V5 947_1019delinsC;1131_1175del n/a
8 TRCN0000480225 GACAGTGGGGGTGATCTCGGAGCG pLX_317 22.3% 92.7% 92.6% V5 947_1019delinsC;1131_1175del n/a
9 ccsbBroadEn_14566 pDONR223 100% 74.8% 42.6% None (many diffs) n/a
10 ccsbBroad304_14566 pLX_304 0% 74.8% 42.6% V5 (not translated due to prior stop codon) (many diffs) n/a
11 TRCN0000480621 AAGACTGTGGCACCAACTCCCGCC pLX_317 29.4% 74.8% 42.6% V5 (not translated due to prior stop codon) (many diffs) n/a
12 TRCN0000489162 ACTTTTCATACCCTAGATACCCAC pLX_317 21.2% 71.2% 75.5% V5 (not translated due to prior stop codon) (many diffs) n/a
13 TRCN0000489374 GACATACGTTCGACTGTGGTTCTC pLX_317 23.3% 71.1% 75.5% V5 (many diffs) n/a
14 ccsbBroadEn_14562 pDONR223 100% 71% 38.3% None (many diffs) n/a
15 ccsbBroad304_14562 pLX_304 0% 71% 38.3% V5 (not translated due to prior stop codon) (many diffs) n/a
16 TRCN0000474396 TAATTGTTATTCACCCAAGAGACT pLX_317 23.8% 71% 38.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV