Transcript: Mouse NM_178675.4

Mus musculus solute carrier family 35, member F1 (Slc35f1), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Slc35f1 (215085)
Length:
4973
CDS:
497..1723

Additional Resources:

NCBI RefSeq record:
NM_178675.4
NBCI Gene record:
Slc35f1 (215085)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178675.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000143999 CCACATAACAAAGCACACTAA pLKO.1 4676 3UTR 100% 4.950 6.930 N SLC35F1 n/a
2 TRCN0000069446 GTTTGGTCTCTACAGCTTTAT pLKO.1 1375 CDS 100% 13.200 9.240 N Slc35f1 n/a
3 TRCN0000069445 CTCATAGACTTGGAAGCTAAT pLKO.1 905 CDS 100% 10.800 7.560 N Slc35f1 n/a
4 TRCN0000069444 CCAGAGCTTTCTGAACTACAT pLKO.1 781 CDS 100% 4.950 3.465 N Slc35f1 n/a
5 TRCN0000139322 CCTGCATGTTTGGTCTCTACA pLKO.1 1368 CDS 100% 4.950 3.465 N SLC35F1 n/a
6 TRCN0000069443 CCTGGGAATGATTGGTCTCTT pLKO.1 1243 CDS 100% 4.950 3.465 N Slc35f1 n/a
7 TRCN0000139398 CAAAGTGCTGAACAGGGAGAT pLKO.1 655 CDS 100% 4.050 2.835 N SLC35F1 n/a
8 TRCN0000069447 GTGCATTTCATCGGCATCGTA pLKO.1 1046 CDS 100% 3.000 2.100 N Slc35f1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178675.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05272 pDONR223 100% 90.2% 96.8% None (many diffs) n/a
2 ccsbBroad304_05272 pLX_304 0% 90.2% 96.8% V5 (many diffs) n/a
3 TRCN0000475861 ACTTAAAAACAATAAGAATTAGCG pLX_317 30.4% 90.2% 96.8% V5 (many diffs) n/a
4 ccsbBroadEn_09882 pDONR223 100% 90% 96.3% None (many diffs) n/a
5 ccsbBroad304_09882 pLX_304 0% 90% 96.3% V5 (many diffs) n/a
6 TRCN0000481532 AACAAGTTACTTTTCCAGCTACGT pLX_317 40.4% 90% 96.3% V5 (many diffs) n/a
Download CSV