Transcript: Human NR_024528.1

Homo sapiens ribosomal protein L23a pseudogene 7 (RPL23AP7), transcript variant 1, non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
RPL23AP7 (118433)
Length:
1482
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_024528.1
NBCI Gene record:
RPL23AP7 (118433)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_024528.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000256052 ACTATGCTATCATCAAGTTTC pLKO_005 690 3UTR 100% 10.800 5.400 Y RPL23AP42 n/a
2 TRCN0000256055 CCAAGAAGGCAGTGTTGAAAG pLKO_005 541 3UTR 100% 10.800 5.400 Y RPL23AP42 n/a
3 TRCN0000117439 CCACCCTGATTTGTCCTGATA pLKO.1 846 3UTR 100% 4.950 2.475 Y RPL23AP82 n/a
4 TRCN0000075032 CCACTATGCTATCATCAAGTT pLKO.1 688 3UTR 100% 4.950 2.475 Y RPL23A n/a
5 TRCN0000117438 GCCGTGAAGAAGATAGAAGAA pLKO.1 728 3UTR 100% 4.950 2.475 Y RPL23AP82 n/a
6 TRCN0000117440 CCTGATTATGATGCTTTCGAT pLKO.1 896 3UTR 100% 3.000 1.500 Y RPL23AP82 n/a
7 TRCN0000117437 GCAGAATAGGAATTTATGCTT pLKO.1 1103 3UTR 100% 3.000 1.500 Y RPL23AP82 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_024528.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06884 pDONR223 100% 28.6% None (many diffs) n/a
2 ccsbBroad304_06884 pLX_304 0% 28.6% V5 (many diffs) n/a
3 TRCN0000466199 GAATTTGCATACAAAGTAATAGGC pLX_317 60.8% 28.6% V5 (many diffs) n/a
4 ccsbBroadEn_10539 pDONR223 100% 24.2% None (many diffs) n/a
5 ccsbBroad304_10539 pLX_304 0% 24.2% V5 (many diffs) n/a
6 ccsbBroadEn_10348 pDONR223 100% 24% None (many diffs) n/a
7 ccsbBroad304_10348 pLX_304 0% 24% V5 (many diffs) n/a
8 ccsbBroadEn_10513 pDONR223 100% 23.6% None (many diffs) n/a
9 ccsbBroad304_10513 pLX_304 0% 23.6% V5 (many diffs) n/a
10 TRCN0000477975 CCAATGGATACCGTATTGCATTCA pLX_317 100% 23.6% V5 (many diffs) n/a
11 ccsbBroadEn_10512 pDONR223 100% 23.6% None (many diffs) n/a
12 ccsbBroad304_10512 pLX_304 0% 23.6% V5 (many diffs) n/a
13 TRCN0000465522 GAATTGCGCGCTTCAACACGCTAT pLX_317 87.8% 23.6% V5 (many diffs) n/a
14 ccsbBroadEn_13729 pDONR223 100% 14.5% None (many diffs) n/a
15 ccsbBroad304_13729 pLX_304 0% 14.5% V5 (many diffs) n/a
16 TRCN0000470954 GGCGTCGGCGCACGAACGTAGATG pLX_317 100% 14.5% V5 (many diffs) n/a
Download CSV