Transcript: Human NR_028077.2

Homo sapiens zinc finger and SCAN domain containing 12 (ZSCAN12), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
ZSCAN12 (9753)
Length:
4323
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_028077.2
NBCI Gene record:
ZSCAN12 (9753)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_028077.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013506 CGTTCCATACTTACTCAGCAT pLKO.1 1351 3UTR 100% 2.640 2.112 N ZSCAN12 n/a
2 TRCN0000415215 GAAATGAGTATGGGAATTTAA pLKO_005 725 3UTR 100% 15.000 10.500 N ZSCAN12 n/a
3 TRCN0000432343 ATCAGTGCACTCAGTGTAATA pLKO_005 1316 3UTR 100% 13.200 9.240 N ZSCAN12 n/a
4 TRCN0000013503 CCTGGATGATTATCTCTGTTT pLKO.1 3184 3UTR 100% 4.950 3.465 N ZSCAN12 n/a
5 TRCN0000013504 CCAAAGTATGAATCTCCAGAA pLKO.1 664 3UTR 100% 4.050 2.835 N ZSCAN12 n/a
6 TRCN0000013507 CCATCAGGAAATCCACCACAA pLKO.1 1452 3UTR 100% 4.050 2.835 N ZSCAN12 n/a
7 TRCN0000013505 CCAGAGAAGATAAACAACCTA pLKO.1 878 3UTR 100% 3.000 2.100 N ZSCAN12 n/a
8 TRCN0000139610 CGAACTCCTGACCTTGTGATA pLKO.1 3746 3UTR 100% 4.950 2.475 Y RBM48 n/a
9 TRCN0000130146 CAGGTTCAAGTGATTCTCCTA pLKO.1 3619 3UTR 100% 2.640 1.320 Y DICER1-AS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_028077.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10494 pDONR223 100% 41.8% None 1_159del;1956T>N;1972_4323del n/a
2 ccsbBroad304_10494 pLX_304 0% 41.8% V5 1_159del;1956T>N;1972_4323del n/a
3 TRCN0000465829 CCCTACCTAGCGGGTCATGTGAGA pLX_317 15.7% 41.8% V5 (not translated due to frame shift) 1_159del;1956delT;1972_4323del n/a
4 ccsbBroadEn_13781 pDONR223 100% 5.5% None (many diffs) n/a
5 ccsbBroad304_13781 pLX_304 0% 5.5% V5 (many diffs) n/a
6 TRCN0000469746 TCCCTGCGCCGTCCGGGTTTTCGA pLX_317 100% 5.5% V5 (many diffs) n/a
7 ccsbBroadEn_12783 pDONR223 100% 4.4% None (many diffs) n/a
8 ccsbBroad304_12783 pLX_304 0% 4.4% V5 (many diffs) n/a
9 TRCN0000478282 TATCTGCTCCACCGGGCTCCGTTG pLX_317 100% 4.4% V5 (many diffs) n/a
10 ccsbBroadEn_15487 pDONR223 0% 3.7% None (many diffs) n/a
11 ccsbBroad304_15487 pLX_304 0% 3.7% V5 (many diffs) n/a
12 TRCN0000473708 TAGCATCGTTGCACGCGCACGTTG pLX_317 100% 3.7% V5 (many diffs) n/a
Download CSV