Transcript: Mouse NM_001285455.1

Mus musculus microtubule-associated protein tau (Mapt), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Mapt (17762)
Length:
5141
CDS:
186..1238

Additional Resources:

NCBI RefSeq record:
NM_001285455.1
NBCI Gene record:
Mapt (17762)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001285455.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083976 GCAGTGTGCAAATAGTCTACA pLKO.1 823 CDS 100% 4.950 3.960 N MAPT n/a
2 TRCN0000091302 TGGAGCAGAAATTGTGTATAA pLKO.1 1076 CDS 100% 13.200 9.240 N Mapt n/a
3 TRCN0000415611 ACAGAGTCCAGTCGAAGATTG pLKO_005 955 CDS 100% 10.800 7.560 N MAPT n/a
4 TRCN0000091298 ACAGGAAATGACGAGAAGAAA pLKO.1 309 CDS 100% 5.625 3.938 N Mapt n/a
5 TRCN0000091300 GACAGAGTCCAGTCGAAGATT pLKO.1 954 CDS 100% 5.625 3.938 N Mapt n/a
6 TRCN0000083977 CAGTGTGCAAATAGTCTACAA pLKO.1 824 CDS 100% 4.950 3.465 N MAPT n/a
7 TRCN0000091299 GTTAGGGAACATCCATCACAA pLKO.1 884 CDS 100% 4.950 3.465 N Mapt n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001285455.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00973 pDONR223 100% 78.9% 84.1% None (many diffs) n/a
2 ccsbBroad304_00973 pLX_304 0% 78.9% 84.1% V5 (many diffs) n/a
3 TRCN0000480553 GCCGGAGTCGAAAGACCATACAGA pLX_317 33.3% 78.9% 84.1% V5 (many diffs) n/a
4 TRCN0000489348 TTCGATTCCAATTCTGAGTTCTTA pLX_317 30.2% 78.8% 83.8% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000489050 CTCCCAGCGGGGCTTAGTTTTTAA pLX_317 26.8% 78.8% 83.8% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000489602 TGCAGCAGCAGTCACCCCGGTGCG pLX_317 31.1% 73.2% 78.2% V5 (not translated due to prior stop codon) (many diffs) n/a
7 TRCN0000488420 ACCAAGTGGCGACCCGGCACATGC pLX_317 31% 73.2% 78% V5 (many diffs) n/a
8 TRCN0000489600 CGCCCGGTTAACGGTCCACACAAC pLX_317 30.5% 73.2% 78% V5 (not translated due to prior stop codon) (many diffs) n/a
9 TRCN0000489514 ATGGGGGTCTATGAAACTGGAGAA pLX_317 27.4% 73.2% 78% V5 (not translated due to prior stop codon) (many diffs) n/a
10 TRCN0000488627 ATCCATCTCCACAGGTGGATTGCA pLX_317 30.1% 73.2% 78% V5 (not translated due to prior stop codon) (many diffs) n/a
11 TRCN0000491761 TCTTCCCTGGCGGTGGTGTGACCC pLX_317 31% 73.1% 77.8% V5 (many diffs) n/a
12 TRCN0000491690 TCGTACACCCAAAATGCCAAGGTC pLX_317 31% 73.1% 77.8% V5 (many diffs) n/a
13 TRCN0000488826 GGCCCCATGATCTCATTCTTTTAC pLX_317 31.2% 73.1% 78% V5 (not translated due to prior stop codon) (many diffs) n/a
14 TRCN0000491287 TTTAATTGATCTAATCTACTCAAT pLX_317 24.7% 73% 77.8% V5 (many diffs) n/a
15 TRCN0000489210 AGACGGATTCCTACTAATTGTCAG pLX_317 29.1% 71.1% 76.1% V5 (not translated due to prior stop codon) (many diffs) n/a
16 TRCN0000489265 TAAAGTCAATTACTGTATAGATGC pLX_317 26.3% 68.4% 73.1% V5 (not translated due to prior stop codon) (many diffs) n/a
17 TRCN0000489485 TCAGAACGAACATCTAAGATCTCT pLX_317 28% 68.4% 72.9% V5 (not translated due to prior stop codon) (many diffs) n/a
18 TRCN0000488697 AGATCTAAGGGCGCCCCACTAGCC pLX_317 28.1% 68.4% 72.9% V5 (not translated due to prior stop codon) (many diffs) n/a
19 TRCN0000489653 TCATCCCTTTTTCTTCACCTTATA pLX_317 33.4% 65.9% 70.6% V5 (many diffs) n/a
20 TRCN0000488263 CTATACCCTTTCCCTAGATCAACC pLX_317 25.7% 64.4% 68.3% V5 (not translated due to prior stop codon) (many diffs) n/a
21 TRCN0000488920 CAATCAGCTAGGCTTACGTGGGGC pLX_317 30.2% 61.7% 66.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV