Transcript: Human XM_005257366.3

PREDICTED: Homo sapiens microtubule associated protein tau (MAPT), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAPT (4137)
Length:
6722
CDS:
145..2559

Additional Resources:

NCBI RefSeq record:
XM_005257366.3
NBCI Gene record:
MAPT (4137)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005257366.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437947 GGCGGGAAGGTGCAGATAATT pLKO_005 2047 CDS 100% 15.000 21.000 N MAPT n/a
2 TRCN0000415611 ACAGAGTCCAGTCGAAGATTG pLKO_005 2276 CDS 100% 10.800 15.120 N MAPT n/a
3 TRCN0000091300 GACAGAGTCCAGTCGAAGATT pLKO.1 2275 CDS 100% 5.625 7.875 N Mapt n/a
4 TRCN0000083977 CAGTGTGCAAATAGTCTACAA pLKO.1 2145 CDS 100% 4.950 6.930 N MAPT n/a
5 TRCN0000083975 GTGTGGCTCATTAGGCAACAT pLKO.1 2196 CDS 100% 4.950 6.930 N MAPT n/a
6 TRCN0000439119 GTCCCTGGCGGAGGAAATAAA pLKO_005 2320 CDS 100% 15.000 10.500 N MAPT n/a
7 TRCN0000083973 GCAGCAACAAAGGATTTGAAA pLKO.1 2990 3UTR 100% 5.625 3.938 N MAPT n/a
8 TRCN0000083974 CCAGTCCAAGTGTGGCTCAAA pLKO.1 2094 CDS 100% 4.950 3.465 N MAPT n/a
9 TRCN0000083976 GCAGTGTGCAAATAGTCTACA pLKO.1 2144 CDS 100% 4.950 3.465 N MAPT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005257366.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489265 TAAAGTCAATTACTGTATAGATGC pLX_317 26.3% 53% 49.5% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489485 TCAGAACGAACATCTAAGATCTCT pLX_317 28% 53% 49.3% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000488697 AGATCTAAGGGCGCCCCACTAGCC pLX_317 28.1% 53% 49.3% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000489602 TGCAGCAGCAGTCACCCCGGTGCG pLX_317 31.1% 50.6% 45.9% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000488420 ACCAAGTGGCGACCCGGCACATGC pLX_317 31% 50.6% 45.9% V5 (many diffs) n/a
6 TRCN0000489600 CGCCCGGTTAACGGTCCACACAAC pLX_317 30.5% 50.6% 45.8% V5 (not translated due to prior stop codon) (many diffs) n/a
7 TRCN0000489514 ATGGGGGTCTATGAAACTGGAGAA pLX_317 27.4% 50.6% 45.8% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000488627 ATCCATCTCCACAGGTGGATTGCA pLX_317 30.1% 50.6% 45.8% V5 (not translated due to prior stop codon) (many diffs) n/a
9 TRCN0000491761 TCTTCCCTGGCGGTGGTGTGACCC pLX_317 31% 50.5% 45.8% V5 (many diffs) n/a
10 TRCN0000491690 TCGTACACCCAAAATGCCAAGGTC pLX_317 31% 50.5% 45.8% V5 (many diffs) n/a
11 TRCN0000488826 GGCCCCATGATCTCATTCTTTTAC pLX_317 31.2% 50.5% 45.8% V5 (not translated due to prior stop codon) (many diffs) n/a
12 TRCN0000491287 TTTAATTGATCTAATCTACTCAAT pLX_317 24.7% 50.5% 45.8% V5 (many diffs) n/a
13 TRCN0000488263 CTATACCCTTTCCCTAGATCAACC pLX_317 25.7% 50.4% 46.8% V5 (not translated due to prior stop codon) (many diffs) n/a
14 TRCN0000488920 CAATCAGCTAGGCTTACGTGGGGC pLX_317 30.2% 49.2% 45.6% V5 (not translated due to prior stop codon) (many diffs) n/a
15 ccsbBroadEn_00973 pDONR223 100% 47.6% 47.6% None 197_1261del;1317_1514del n/a
16 ccsbBroad304_00973 pLX_304 0% 47.6% 47.6% V5 197_1261del;1317_1514del n/a
17 TRCN0000480553 GCCGGAGTCGAAAGACCATACAGA pLX_317 33.3% 47.6% 47.6% V5 197_1261del;1317_1514del n/a
18 TRCN0000489348 TTCGATTCCAATTCTGAGTTCTTA pLX_317 30.2% 47.5% 47.5% V5 (not translated due to prior stop codon) 197_1261del;1317_1514del;1991C>T n/a
19 TRCN0000489050 CTCCCAGCGGGGCTTAGTTTTTAA pLX_317 26.8% 47.5% 47.5% V5 (not translated due to prior stop codon) 197_1261del;1317_1514del;1990C>T n/a
20 TRCN0000489653 TCATCCCTTTTTCTTCACCTTATA pLX_317 33.4% 46.7% 42.2% V5 (many diffs) n/a
21 TRCN0000489210 AGACGGATTCCTACTAATTGTCAG pLX_317 29.1% 43.7% 43.7% V5 (not translated due to prior stop codon) 197_1261del;1317_1514del;1912_2004del n/a
Download CSV