Transcript: Mouse XM_017317781.1

PREDICTED: Mus musculus F-box protein 38 (Fbxo38), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fbxo38 (107035)
Length:
3740
CDS:
757..3099

Additional Resources:

NCBI RefSeq record:
XM_017317781.1
NBCI Gene record:
Fbxo38 (107035)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317781.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249720 GTGGATGCGACTGGTTGATAT pLKO_005 789 CDS 100% 13.200 18.480 N Fbxo38 n/a
2 TRCN0000173406 GCAGATCAAAGCCGATATGAA pLKO.1 1557 CDS 100% 5.625 7.875 N Fbxo38 n/a
3 TRCN0000215399 CATCAATCAAGAGCTCATTAA pLKO.1 2694 CDS 100% 13.200 9.240 N Fbxo38 n/a
4 TRCN0000249721 CATCAATCAAGAGCTCATTAA pLKO_005 2694 CDS 100% 13.200 9.240 N Fbxo38 n/a
5 TRCN0000249722 GTGTTTATATTTGGCATATTC pLKO_005 3578 3UTR 100% 13.200 9.240 N Fbxo38 n/a
6 TRCN0000249723 TGTCCCATGTACCGCTGATAT pLKO_005 2156 CDS 100% 13.200 9.240 N Fbxo38 n/a
7 TRCN0000175255 CTGTATCAAATATCTGGCAAT pLKO.1 571 5UTR 100% 4.050 2.835 N Fbxo38 n/a
8 TRCN0000175377 CCTGTATCAAATATCTGGCAA pLKO.1 570 5UTR 100% 2.640 1.848 N Fbxo38 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317781.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09069 pDONR223 100% 51.9% 53.4% None (many diffs) n/a
2 ccsbBroad304_09069 pLX_304 0% 51.9% 53.4% V5 (many diffs) n/a
3 ccsbBroadEn_16008 pDONR223 0% 49.7% 52.9% None (many diffs) n/a
4 ccsbBroad304_16008 pLX_304 0% 49.7% 52.9% V5 (many diffs) n/a
5 TRCN0000478966 GTGCCATGCGGCGACGTTTAAGTC pLX_317 29.6% 49.7% 52.9% V5 (many diffs) n/a
6 ccsbBroadEn_12717 pDONR223 100% 38.8% 40.9% None (many diffs) n/a
7 ccsbBroad304_12717 pLX_304 0% 38.8% 40.9% V5 (many diffs) n/a
8 TRCN0000471001 CTAGATGGCACTAGGATAACCACC pLX_317 13.5% 38.8% 40.9% V5 (many diffs) n/a
Download CSV