Transcript: Human NM_001351032.2

Homo sapiens calcium/calmodulin dependent protein kinase ID (CAMK1D), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
CAMK1D (57118)
Length:
2224
CDS:
703..1485

Additional Resources:

NCBI RefSeq record:
NM_001351032.2
NBCI Gene record:
CAMK1D (57118)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001351032.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197282 GCCGTCCTGAGAAAGATTAAG pLKO.1 622 5UTR 100% 13.200 18.480 N CAMK1D n/a
2 TRCN0000352651 GCCGTCCTGAGAAAGATTAAG pLKO_005 622 5UTR 100% 13.200 18.480 N CAMK1D n/a
3 TRCN0000195531 CGGAGTGATTGCCTACATCTT pLKO.1 1032 CDS 100% 4.950 6.930 N CAMK1D n/a
4 TRCN0000342579 CGGAGTGATTGCCTACATCTT pLKO_005 1032 CDS 100% 4.950 6.930 N CAMK1D n/a
5 TRCN0000195224 CTATACTTAATCCCATGTCAT pLKO.1 1559 3UTR 100% 4.950 6.930 N CAMK1D n/a
6 TRCN0000195715 CAGATCCTCAAGGCGGAATAT pLKO.1 1105 CDS 100% 13.200 9.240 N CAMK1D n/a
7 TRCN0000001756 TGATGGAGAAGGACCCGAATA pLKO.1 1187 CDS 100% 10.800 7.560 N CAMK1D n/a
8 TRCN0000342628 TGATGGAGAAGGACCCGAATA pLKO_005 1187 CDS 100% 10.800 7.560 N CAMK1D n/a
9 TRCN0000001755 AGAGCTGTTTGACCGGATAGT pLKO.1 723 CDS 100% 4.950 3.465 N CAMK1D n/a
10 TRCN0000342578 AGAGCTGTTTGACCGGATAGT pLKO_005 723 CDS 100% 4.950 3.465 N CAMK1D n/a
11 TRCN0000197125 GACTTCATTCGGAACCTGATG pLKO.1 1171 CDS 100% 4.050 2.835 N CAMK1D n/a
12 TRCN0000001752 TGCTGTGAAGTGTATCCCTAA pLKO.1 558 5UTR 100% 4.050 2.835 N CAMK1D n/a
13 TRCN0000001754 AGGCGGAATATGAGTTTGACT pLKO.1 1115 CDS 100% 3.000 2.100 N CAMK1D n/a
14 TRCN0000342580 AGGCGGAATATGAGTTTGACT pLKO_005 1115 CDS 100% 3.000 2.100 N CAMK1D n/a
15 TRCN0000001753 AGAATGAGATAGCCGTCCTGA pLKO.1 611 5UTR 100% 2.640 1.848 N CAMK1D n/a
16 TRCN0000074123 CGCCTGTAATCCCAACACTTT pLKO.1 1634 3UTR 100% 4.950 2.475 Y GJD4 n/a
17 TRCN0000166650 CGCCTGTAATCCCAACACTTT pLKO.1 1634 3UTR 100% 4.950 2.475 Y C9orf85 n/a
18 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 1703 3UTR 100% 13.200 6.600 Y IQCC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001351032.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489121 ACCATGACATTCTAAAGTACAACG pLX_317 28.3% 72.4% 72.3% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_08703 pDONR223 100% 65.8% 65.1% None (many diffs) n/a
3 ccsbBroad304_08703 pLX_304 0% 65.8% 65.1% V5 (many diffs) n/a
4 TRCN0000472635 AAAGGACCTGACCAGAGAAGTGCC pLX_317 33.2% 65.8% 65.1% V5 (many diffs) n/a
5 ccsbBroadEn_15118 pDONR223 0% 65.8% 65.1% None (many diffs) n/a
6 ccsbBroad304_15118 pLX_304 0% 65.8% 65.1% V5 (many diffs) n/a
7 TRCN0000468350 TATCTGAATCAGCCTGATTTTGGG pLX_317 33.2% 65.8% 65.1% V5 (many diffs) n/a
Download CSV