Transcript: Mouse XM_006499508.3

PREDICTED: Mus musculus p21 protein (Cdc42/Rac)-activated kinase 7 (Pak7), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pak7 (241656)
Length:
4425
CDS:
92..2302

Additional Resources:

NCBI RefSeq record:
XM_006499508.3
NBCI Gene record:
Pak7 (241656)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006499508.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000362325 ACAAACTCCGTTACGATATAT pLKO_005 2588 3UTR 100% 15.000 21.000 N Pak7 n/a
2 TRCN0000362387 GACAAGCGATGGCCGGATAAA pLKO_005 1870 CDS 100% 13.200 18.480 N Pak7 n/a
3 TRCN0000378210 GACAAGCGATGGCCGGATAAA pLKO_005 1870 CDS 100% 13.200 18.480 N PAK5 n/a
4 TRCN0000025169 GCCCACAATGTGCATTCCAAA pLKO.1 1111 CDS 100% 4.950 3.960 N Pak7 n/a
5 TRCN0000025170 CGGATAAAGTTATCTGACTTT pLKO.1 1883 CDS 100% 0.495 0.396 N Pak7 n/a
6 TRCN0000362324 GACCTGGATCTGTACTATAAA pLKO_005 605 CDS 100% 15.000 10.500 N Pak7 n/a
7 TRCN0000025173 CCTTGGACATCCATTCTTAAA pLKO.1 2224 CDS 100% 13.200 9.240 N Pak7 n/a
8 TRCN0000362251 GGTCGTGATAATGCGTGATTA pLKO_005 1624 CDS 100% 13.200 9.240 N Pak7 n/a
9 TRCN0000025172 CCTGCAAACCAGTTCTCAGTA pLKO.1 1303 CDS 100% 4.950 3.465 N Pak7 n/a
10 TRCN0000025171 CGCTCCAACTCTCTAAGGAAA pLKO.1 428 CDS 100% 4.950 3.465 N Pak7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006499508.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492001 ACCAAGCTCAGTTCCCCAATTCTT pLX_317 20.4% 87.6% 91.7% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489786 AGTCCAGCTCTGGGATATCCCCCT pLX_317 12.7% 87.5% 91.5% V5 (many diffs) n/a
3 ccsbBroadEn_08707 pDONR223 100% 87.5% 91.4% None (many diffs) n/a
4 ccsbBroad304_08707 pLX_304 0% 87.5% 91.4% V5 (many diffs) n/a
5 TRCN0000475334 GCTGCATCGACTAAAAGGCGAGCC pLX_317 15.2% 87.5% 91.4% V5 (many diffs) n/a
6 ccsbBroadEn_15120 pDONR223 0% 87.5% 91.4% None (many diffs) n/a
7 ccsbBroad304_15120 pLX_304 0% 87.5% 91.4% V5 (many diffs) n/a
8 TRCN0000471919 TTCACAAAGACGCGCTTACACAGA pLX_317 18.5% 87.5% 91.4% V5 (many diffs) n/a
9 TRCN0000487983 GCAAGTCAACACTGGCGGTTTTAG pLX_317 14.1% 86.3% 90.4% V5 (not translated due to prior stop codon) (many diffs) n/a
10 TRCN0000489367 GCCTTACCTGATAATTGCTTTTCG pLX_317 17.3% 86.2% 90.3% V5 (many diffs) n/a
Download CSV