Transcript: Mouse XM_006507180.1

PREDICTED: Mus musculus integrator complex subunit 4 (Ints4), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ints4 (101861)
Length:
3222
CDS:
147..3014

Additional Resources:

NCBI RefSeq record:
XM_006507180.1
NBCI Gene record:
Ints4 (101861)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006507180.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000178529 GAACTCTTATGCTGCACTAAT pLKO.1 1527 CDS 100% 13.200 18.480 N Ints4 n/a
2 TRCN0000181440 CCGTCTAGTTGATGATGCATT pLKO.1 953 CDS 100% 4.950 6.930 N Ints4 n/a
3 TRCN0000353220 CCGTCTAGTTGATGATGCATT pLKO_005 953 CDS 100% 4.950 6.930 N Ints4 n/a
4 TRCN0000182217 CCGATTAACAAAGCCGAGCAA pLKO.1 233 CDS 100% 2.640 3.696 N Ints4 n/a
5 TRCN0000198023 CCTGAGAGTATAGTTCCAATA pLKO.1 912 CDS 100% 10.800 8.640 N Ints4 n/a
6 TRCN0000345872 CCTGAGAGTATAGTTCCAATA pLKO_005 912 CDS 100% 10.800 8.640 N Ints4 n/a
7 TRCN0000198148 CCTTGACTTTCTAGTTGACAT pLKO.1 1358 CDS 100% 4.950 3.960 N Ints4 n/a
8 TRCN0000345873 CCTTGACTTTCTAGTTGACAT pLKO_005 1358 CDS 100% 4.950 3.960 N Ints4 n/a
9 TRCN0000198289 GCATCACTCTTGGGATTATTA pLKO.1 426 CDS 100% 15.000 10.500 N Ints4 n/a
10 TRCN0000345871 GCATCACTCTTGGGATTATTA pLKO_005 426 CDS 100% 15.000 10.500 N Ints4 n/a
11 TRCN0000177087 CCTTATTTGGAATGTGTGAAA pLKO.1 2359 CDS 100% 4.950 3.465 N Ints4 n/a
12 TRCN0000131114 GCTCCATGAAAGAGGACTGAA pLKO.1 785 CDS 100% 4.950 3.465 N INTS4 n/a
13 TRCN0000181439 CTGCACTAATGTCTCAACCAA pLKO.1 1538 CDS 100% 3.000 2.100 N Ints4 n/a
14 TRCN0000219596 CATAATGGACGACGCCATTAA pLKO.1 476 CDS 100% 1.320 0.924 N Ints4 n/a
15 TRCN0000182093 CAGGAGAGTCAGACAATCCTT pLKO.1 2605 CDS 100% 3.000 1.800 N Ints4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006507180.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12974 pDONR223 100% 47% 50.6% None (many diffs) n/a
2 ccsbBroad304_12974 pLX_304 0% 47% 50.6% V5 (many diffs) n/a
3 TRCN0000470961 GAATTATTCATAGACCCCCAATAG pLX_317 30.1% 47% 50.6% V5 (many diffs) n/a
4 ccsbBroadEn_12975 pDONR223 100% 47% 47.9% None (many diffs) n/a
5 ccsbBroad304_12975 pLX_304 0% 47% 47.9% V5 (many diffs) n/a
6 TRCN0000491572 TCTTGCAAAAGGGGAGCATACACC pLX_317 25% 47% 47.9% V5 (many diffs) n/a
7 ccsbBroadEn_13723 pDONR223 100% 40.4% 38.8% None (many diffs) n/a
8 ccsbBroad304_13723 pLX_304 0% 40.4% 38.8% V5 (many diffs) n/a
9 TRCN0000469026 TTGCGCAAGTTGCCCGAAACCAAC pLX_317 32.2% 40.4% 38.8% V5 (many diffs) n/a
Download CSV