Transcript: Human XM_017026800.2

PREDICTED: Homo sapiens zinc finger protein 888 (ZNF888), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF888 (388559)
Length:
3599
CDS:
176..2224

Additional Resources:

NCBI RefSeq record:
XM_017026800.2
NBCI Gene record:
ZNF888 (388559)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017026800.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239528 ACGGGTAGTACAGACCAATAT pLKO_005 422 CDS 100% 13.200 9.240 N ZNF888 n/a
2 TRCN0000239530 TCGTGCACAGTCAACACTTAT pLKO_005 2164 CDS 100% 13.200 9.240 N ZNF888 n/a
3 TRCN0000239527 GACAAGGCTTTCAAGTGTTAC pLKO_005 2069 CDS 100% 10.800 7.560 N ZNF888 n/a
4 TRCN0000239526 AGCATACCTTGCACGTCATTA pLKO_005 913 CDS 100% 13.200 7.920 N ZNF888 n/a
5 TRCN0000239529 TCACACCTGGCACAGCATATT pLKO_005 1250 CDS 100% 13.200 7.920 N ZNF888 n/a
6 TRCN0000021905 GACGTGATGCTGGAGAATTAT pLKO.1 170 5UTR 100% 15.000 7.500 Y ZNF765 n/a
7 TRCN0000147524 GAGAGTGGCAAATCCTTTAAT pLKO.1 719 CDS 100% 15.000 7.500 Y ZNF321P n/a
8 TRCN0000018107 GCTGGAAACAAGCCTATTAAA pLKO.1 455 CDS 100% 15.000 7.500 Y ZNF600 n/a
9 TRCN0000021906 CCCTGCTCAGAGGACTCTATA pLKO.1 145 5UTR 100% 13.200 6.600 Y ZNF765 n/a
10 TRCN0000015887 GTGAAGAATGTGACAAAGTTT pLKO.1 1890 CDS 100% 5.625 2.813 Y ZNF702P n/a
11 TRCN0000021908 TCAGGGATGTGGCCATAGAAT pLKO.1 96 5UTR 100% 5.625 2.813 Y ZNF765 n/a
12 TRCN0000150044 CCTTGAAAGACATAGGAGAAT pLKO.1 1171 CDS 100% 4.950 2.475 Y ZNF816 n/a
13 TRCN0000149463 GCACGTCATCATAGACTTCAT pLKO.1 1427 CDS 100% 4.950 2.475 Y ZNF321P n/a
14 TRCN0000150214 GTAATGAATGTGGCAAGGTTT pLKO.1 1050 CDS 100% 4.950 2.475 Y ZNF813 n/a
15 TRCN0000141128 CCTCAGTTTCAACATCCCAAA pLKO.1 579 CDS 100% 4.050 2.025 Y ZNF468 n/a
16 TRCN0000021907 GCTGGAGAATTATAGGAACCT pLKO.1 178 CDS 100% 2.640 1.320 Y ZNF765 n/a
17 TRCN0000142023 GTAAGGTTTGTGACAAGGCTT pLKO.1 1218 CDS 100% 2.640 1.320 Y ZNF468 n/a
18 TRCN0000158848 GAGAAACCTTACAAATGTGAT pLKO.1 1874 CDS 100% 4.950 2.475 Y ZNF28 n/a
19 TRCN0000141972 GCACAACATCAGAGAGTTCAT pLKO.1 2015 CDS 100% 4.950 2.475 Y ZNF468 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017026800.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04800 pDONR223 100% 63.2% 55.9% None (many diffs) n/a
2 ccsbBroad304_04800 pLX_304 0% 63.2% 55.9% V5 (many diffs) n/a
3 TRCN0000478315 CGTGCCTTGTCGAAGCCACGTTAA pLX_317 18.1% 63.2% 55.9% V5 (many diffs) n/a
4 ccsbBroadEn_08581 pDONR223 100% 55.4% 51% None (many diffs) n/a
5 ccsbBroad304_08581 pLX_304 0% 55.4% 51% V5 (many diffs) n/a
6 TRCN0000476486 AGTATTTAAATCGATGTCTATAAC pLX_317 30.4% 55.4% 51% V5 (many diffs) n/a
7 ccsbBroadEn_05629 pDONR223 100% 21.6% 18.3% None (many diffs) n/a
8 ccsbBroad304_05629 pLX_304 0% 21.6% 18.3% V5 (many diffs) n/a
9 TRCN0000468214 TCTCTAGTACCTCAATAGGTGGTT pLX_317 94.7% 21.6% 18.3% V5 (many diffs) n/a
10 ccsbBroadEn_12938 pDONR223 100% 11.6% 5% None (many diffs) n/a
11 ccsbBroad304_12938 pLX_304 0% 11.6% 5% V5 (many diffs) n/a
12 TRCN0000465769 GCGACGTTTCATCACCCAGACTTT pLX_317 100% 11.6% 5% V5 (many diffs) n/a
Download CSV