Transcript: Human XM_017026989.1

PREDICTED: Homo sapiens mitogen-activated protein kinase kinase 2 (MAP2K2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAP2K2 (5605)
Length:
1879
CDS:
310..1848

Additional Resources:

NCBI RefSeq record:
XM_017026989.1
NBCI Gene record:
MAP2K2 (5605)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017026989.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000199414 CGAATGCAACTCGCCGTACAT pLKO.1 678 CDS 100% 4.950 3.465 N MAP2K2 n/a
2 TRCN0000342310 CGAATGCAACTCGCCGTACAT pLKO_005 678 CDS 100% 4.950 3.465 N MAP2K2 n/a
3 TRCN0000196991 GCATTTGCATGGAACACATGG pLKO.1 740 CDS 100% 4.050 2.835 N MAP2K2 n/a
4 TRCN0000007008 CTGGACTATATTGTGAACGAG pLKO.1 1273 CDS 100% 2.640 1.584 N MAP2K2 n/a
5 TRCN0000007007 TGGACTATATTGTGAACGAGC pLKO.1 1274 CDS 100% 2.160 1.296 N MAP2K2 n/a
6 TRCN0000007006 GACTATATTGTGAACGAGCCA pLKO.1 1276 CDS 100% 0.660 0.396 N MAP2K2 n/a
7 TRCN0000195037 CTTCCAGGAGTTTGTCAATAA pLKO.1 1332 CDS 100% 13.200 6.600 Y MAP2K2 n/a
8 TRCN0000342312 CTTCCAGGAGTTTGTCAATAA pLKO_005 1332 CDS 100% 13.200 6.600 Y MAP2K2 n/a
9 TRCN0000007005 CCAACATCCTCGTGAACTCTA pLKO.1 902 CDS 100% 4.950 2.475 Y MAP2K2 n/a
10 TRCN0000195427 CGAACTCAAAGACGATGACTT pLKO.1 504 CDS 100% 4.950 2.475 Y MAP2K2 n/a
11 TRCN0000342309 CGAACTCAAAGACGATGACTT pLKO_005 504 CDS 100% 4.950 2.475 Y MAP2K2 n/a
12 TRCN0000011062 CAACATCCTCGTGAACTCTAG pLKO.1 903 CDS 100% 4.050 2.025 Y MAP2K2 n/a
13 TRCN0000342311 CAACATCCTCGTGAACTCTAG pLKO_005 903 CDS 100% 4.050 2.025 Y MAP2K2 n/a
14 TRCN0000055065 CCTCCGAGAGAAGCACCAGAT pLKO.1 858 CDS 100% 1.350 0.675 Y Map2k2 n/a
15 TRCN0000288078 CCTCCGAGAGAAGCACCAGAT pLKO_005 858 CDS 100% 1.350 0.675 Y Map2k2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017026989.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487985 AGCCCTCCCGCTAGCATAACCTAG pLX_317 26.4% 75.4% 67.6% V5 (many diffs) n/a
2 TRCN0000488054 AAGGTTTGCCGATAAATCTTAGCG pLX_317 23.1% 75.3% 67.6% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_14808 pDONR223 0% 75.2% 67.6% None (many diffs) n/a
4 ccsbBroad304_14808 pLX_304 0% 75.2% 67.6% V5 (many diffs) n/a
5 TRCN0000465915 AACCGTCGGGCCCACCATGAAATT pLX_317 17.9% 75.2% 67.6% V5 (many diffs) n/a
6 TRCN0000465689 TGACCGAAAAAAAATTTTTCGTTT pLX_317 17.9% 75% 53.3% V5 (not translated due to prior stop codon) (many diffs) n/a
7 ccsbBroadEn_10634 pDONR223 100% 69.7% 64.2% None (many diffs) n/a
8 ccsbBroad304_10634 pLX_304 0% 69.7% 64.2% V5 (many diffs) n/a
9 TRCN0000477744 AAGCGGTCACCAGAATGAGGGTTC pLX_317 27.6% 69.7% 64.2% V5 (many diffs) n/a
10 TRCN0000487698 GCGCTTTTCCTGCACCTTGACTTA pLX_317 23.3% 57.2% 50% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV