Transcript: Human XM_024446658.1

PREDICTED: Homo sapiens leucine rich repeats and guanylate kinase domain containing (LRGUK), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LRGUK (136332)
Length:
5594
CDS:
17..3205

Additional Resources:

NCBI RefSeq record:
XM_024446658.1
NBCI Gene record:
LRGUK (136332)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446658.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000158234 CCATGTTGTCAACAGCGTGAT pLKO.1 979 CDS 100% 4.050 5.670 N LRGUK n/a
2 TRCN0000359288 TTGGATCTTTCAGCGAATAAA pLKO_005 476 CDS 100% 15.000 10.500 N LRGUK n/a
3 TRCN0000359360 GGATCGAGTTGATTATCATTT pLKO_005 1183 CDS 100% 13.200 9.240 N LRGUK n/a
4 TRCN0000157299 CGTTACAGTTTCGCGCAGAAA pLKO.1 102 CDS 100% 4.950 3.465 N LRGUK n/a
5 TRCN0000157300 CTGCCAAGAGTTTGGCTACAA pLKO.1 1626 CDS 100% 0.495 0.347 N LRGUK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446658.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14383 pDONR223 100% 59.3% 1.4% None (many diffs) n/a
2 ccsbBroad304_14383 pLX_304 0% 59.3% 1.4% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000481604 ACTACGGAAGCCATTACGAGATAC pLX_317 20.1% 59.3% 1.4% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_15247 pDONR223 64.4% 59.2% 19.8% None (many diffs) n/a
5 ccsbBroad304_15247 pLX_304 0% 59.2% 19.8% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000474481 AATGAAAAATACAGCGTGCCCAAT pLX_317 16.1% 59.2% 19.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV