Transcript: Human XR_001744857.1

PREDICTED: Homo sapiens B-Raf proto-oncogene, serine/threonine kinase (BRAF), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BRAF (673)
Length:
4775
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001744857.1
NBCI Gene record:
BRAF (673)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001744857.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381659 CCCAAATTCTCGCCTCTATTG pLKO_005 2333 3UTR 100% 10.800 15.120 N BRAF n/a
2 TRCN0000381693 CCCTACCTATGCCTGTGTTTG pLKO_005 2878 3UTR 100% 10.800 15.120 N BRAF n/a
3 TRCN0000006290 CCGCTGTCAAACATGTGGTTA pLKO.1 785 3UTR 100% 4.950 6.930 N BRAF n/a
4 TRCN0000196844 GTCATCAGAATGCAAGATAAA pLKO.1 1998 3UTR 100% 13.200 10.560 N BRAF n/a
5 TRCN0000196918 GAACATATAGAGGCCCTATTG pLKO.1 183 3UTR 100% 10.800 8.640 N BRAF n/a
6 TRCN0000231130 TTACCTGGCTCACTAACTAAC pLKO_005 1344 3UTR 100% 10.800 8.640 N BRAF n/a
7 TRCN0000382327 GCATAATCCACCATCAATATA pLKO_005 221 3UTR 100% 15.000 10.500 N BRAF n/a
8 TRCN0000231129 TTGGTTGGGACACTGATATTT pLKO_005 631 3UTR 100% 15.000 10.500 N BRAF n/a
9 TRCN0000382440 AGAACACTTGTGTGGTTAAAG pLKO_005 2626 3UTR 100% 13.200 9.240 N BRAF n/a
10 TRCN0000195066 CAGCTTTCAGTCAGATGTATA pLKO.1 2027 3UTR 100% 13.200 9.240 N BRAF n/a
11 TRCN0000231132 CGGTTAGCCTGGGTTAGATAA pLKO_005 2918 3UTR 100% 13.200 9.240 N BRAF n/a
12 TRCN0000218636 ATCACCATCTCCATATCATTG pLKO_005 1741 3UTR 100% 10.800 7.560 N BRAF n/a
13 TRCN0000231131 CCTACTCTTCATGGGCTATTC pLKO_005 1667 3UTR 100% 10.800 7.560 N BRAF n/a
14 TRCN0000195609 CTCAGTAAGGTACGGAGTAAC pLKO.1 2242 3UTR 100% 10.800 7.560 N BRAF n/a
15 TRCN0000380549 CTGATGATGAGAGGTCTAATC pLKO_005 561 3UTR 100% 10.800 7.560 N BRAF n/a
16 TRCN0000006289 GCAGATGAAGATCATCGAAAT pLKO.1 1053 3UTR 100% 10.800 7.560 N BRAF n/a
17 TRCN0000006292 CAGCAGTTACAAGCCTTCAAA pLKO.1 1605 3UTR 100% 5.625 3.938 N BRAF n/a
18 TRCN0000379406 AGTTCAGGAGAGTAGCAACAA pLKO_005 2528 3UTR 100% 4.950 3.465 N BRAF n/a
19 TRCN0000006293 CTATGAAGAATACACCAGCAA pLKO.1 251 3UTR 100% 2.640 1.848 N BRAF n/a
20 TRCN0000006291 GCTGGTTTCCAAACAGAGGAT pLKO.1 2416 3UTR 100% 2.640 1.848 N BRAF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001744857.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00174 pDONR223 100% 48.1% None (many diffs) n/a
2 ccsbBroad304_00174 pLX_304 0% 48.1% V5 (many diffs) n/a
3 TRCN0000478042 TCTGAATTAGGGTTGATCCCCCGC pLX_317 17.9% 48.1% V5 (many diffs) n/a
4 TRCN0000489575 CGTTCGGAATTCTGTGTTGTACCC pLX_317 15.7% 48.1% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000489494 GTTAACTACCATGGAAACCTGCTA pLX_317 14.9% 48.1% V5 (not translated due to prior stop codon) (many diffs) n/a
6 ccsbBroadEn_16175 pDONR223 0% 48.1% None (many diffs) n/a
7 ccsbBroad304_16175 pLX_304 0% 48.1% V5 (many diffs) n/a
8 TRCN0000491583 CCCTCTGATACCGCCGCCACCAGA pLX_317 17.6% 48.1% V5 (not translated due to prior stop codon) (many diffs) n/a
9 ccsbBroadEn_14553 pDONR223 65.1% 44.8% None (many diffs) n/a
10 ccsbBroad304_14553 pLX_304 0% 44.8% V5 (not translated due to prior stop codon) (many diffs) n/a
11 TRCN0000480310 GCCCGGTAACTCGCTTTGGCCAAA pLX_317 17.4% 44.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV