Transcript: Human NM_001099269.3

Homo sapiens zinc finger protein 506 (ZNF506), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
ZNF506 (440515)
Length:
3323
CDS:
148..1482

Additional Resources:

NCBI RefSeq record:
NM_001099269.3
NBCI Gene record:
ZNF506 (440515)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001099269.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230752 GCCCTGGACTCTGACTAAATA pLKO_005 1538 3UTR 100% 15.000 10.500 N ZNF506 n/a
2 TRCN0000230750 TGGTACTCAAGCCTCTCTAAA pLKO_005 1201 CDS 100% 13.200 9.240 N ZNF506 n/a
3 TRCN0000230749 GCCTATAAGCAGTCCTGTAAC pLKO_005 856 CDS 100% 10.800 7.560 N ZNF506 n/a
4 TRCN0000230751 TTAGACAGAAACCCTGCATAG pLKO_005 1406 CDS 100% 6.000 4.200 N ZNF506 n/a
5 TRCN0000254728 GCTGGAGAGAAACGCTATAAA pLKO_005 733 CDS 100% 15.000 9.000 N ZNF506 n/a
6 TRCN0000254727 CCCTTAATAAGCATAAGATAA pLKO_005 1462 CDS 100% 13.200 7.920 N ZNF506 n/a
7 TRCN0000265606 CGCTGCACAGCGGAATCTATA pLKO_005 213 CDS 100% 13.200 7.920 N ZNF506 n/a
8 TRCN0000219094 CGTTCCTCAAACCTTACTAAA pLKO_005 1117 CDS 100% 13.200 7.920 N ZNF506 n/a
9 TRCN0000254730 TCATCCTCAACCCTTACTAAA pLKO_005 1033 CDS 100% 13.200 7.920 N ZNF506 n/a
10 TRCN0000254729 TTAAGAGACATGGCGATAATT pLKO_005 2022 3UTR 100% 15.000 7.500 Y ZNF506 n/a
11 TRCN0000236731 ACCTTACTACACATAAGATAA pLKO_005 875 CDS 100% 13.200 6.600 Y ZNF98 n/a
12 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 818 CDS 100% 13.200 6.600 Y Zfp934 n/a
13 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 818 CDS 100% 13.200 6.600 Y 2810408B13Rik n/a
14 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 818 CDS 100% 13.200 6.600 Y EG668616 n/a
15 TRCN0000018502 GATGTTAGAGAACTACAGAAA pLKO.1 243 CDS 100% 4.950 2.475 Y ZNF493 n/a
16 TRCN0000147367 GAATGTGATGAATGTGGGAAA pLKO.1 1506 3UTR 100% 4.050 2.025 Y ZNF658B n/a
17 TRCN0000107875 CACTTGATTGTAGGTAAGATA pLKO.1 2188 3UTR 100% 5.625 2.813 Y ZNF254 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001099269.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09302 pDONR223 100% 79.5% 69.4% None (many diffs) n/a
2 ccsbBroad304_09302 pLX_304 0% 79.5% 69.4% V5 (many diffs) n/a
3 TRCN0000478136 TCTGGATTCCTTTAAAAGGATTTC pLX_317 23% 79.5% 69.4% V5 (many diffs) n/a
4 ccsbBroadEn_08635 pDONR223 100% 79.2% 69.6% None (many diffs) n/a
5 ccsbBroad304_08635 pLX_304 0% 79.2% 69.6% V5 (many diffs) n/a
6 TRCN0000469248 TACCCGCTTGGCTTTAAAAACCAA pLX_317 37.7% 77% 68% V5 (many diffs) n/a
7 ccsbBroadEn_12296 pDONR223 100% 64.8% 55.4% None (many diffs) n/a
8 TRCN0000478211 CAAATCTCTGTTGACCAGACGGTG pLX_317 19.4% 64.8% 55.4% V5 (many diffs) n/a
9 ccsbBroadEn_11550 pDONR223 100% 64.8% 53.7% None (many diffs) n/a
10 ccsbBroad304_11550 pLX_304 0% 64.8% 53.7% V5 (many diffs) n/a
11 ccsbBroadEn_05180 pDONR223 100% 18.4% 15.5% None (many diffs) n/a
12 ccsbBroad304_05180 pLX_304 0% 18.4% 15.5% V5 (many diffs) n/a
13 TRCN0000466983 TATCGTATGCAGTGATGCCATGTC pLX_317 100% 18.4% 15.5% V5 (many diffs) n/a
Download CSV