Transcript: Human NM_001199809.1

Homo sapiens integrator complex subunit 7 (INTS7), transcript variant 4, mRNA.

Source:
NCBI, updated 2018-06-25
Taxon:
Homo sapiens (human)
Gene:
INTS7 (25896)
Length:
4408
CDS:
224..2965

Additional Resources:

NCBI RefSeq record:
NM_001199809.1
NBCI Gene record:
INTS7 (25896)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001199809.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000156142 CGGATCTAAACCAGGACTCTT pLKO.1 2587 CDS 100% 4.950 6.930 N INTS7 n/a
2 TRCN0000416961 AGTTACAGTGTAGTTCATTTA pLKO_005 3051 3UTR 100% 13.200 10.560 N INTS7 n/a
3 TRCN0000422234 AGAGTGCTGTTACCATAATAA pLKO_005 1123 CDS 100% 15.000 10.500 N INTS7 n/a
4 TRCN0000434779 GAATCACTCAATCGGAAATAT pLKO_005 2354 CDS 100% 15.000 10.500 N INTS7 n/a
5 TRCN0000151342 GACTCCTTATGACAGCTTAAA pLKO.1 979 CDS 100% 13.200 9.240 N INTS7 n/a
6 TRCN0000366286 GATCTTCTGATTTAGTCAAAT pLKO_005 1095 CDS 100% 13.200 9.240 N Ints7 n/a
7 TRCN0000429073 GATCTTCTGATTTAGTCAAAT pLKO_005 1095 CDS 100% 13.200 9.240 N INTS7 n/a
8 TRCN0000428689 GTATCCATTCCCTATTCTTAT pLKO_005 385 CDS 100% 13.200 9.240 N INTS7 n/a
9 TRCN0000418838 TGATTACTTCAGTACTCAATT pLKO_005 2731 CDS 100% 13.200 9.240 N INTS7 n/a
10 TRCN0000430422 TTCTCGATATGGAGATCTTTA pLKO_005 2122 CDS 100% 13.200 9.240 N INTS7 n/a
11 TRCN0000150959 GCAGTAAAGAGACTTGCTATT pLKO.1 875 CDS 100% 10.800 7.560 N INTS7 n/a
12 TRCN0000414826 TAACCAGCAGCTGGCGCTAAA pLKO_005 2545 CDS 100% 10.800 7.560 N INTS7 n/a
13 TRCN0000153218 GCAGACTCTCAAGAGATCAAT pLKO.1 2984 3UTR 100% 5.625 3.938 N INTS7 n/a
14 TRCN0000150786 GCATTCCTAAAGTTAGCTGAT pLKO.1 413 CDS 100% 4.050 2.835 N INTS7 n/a
15 TRCN0000154856 GCAGCTTGAAAGTGTCTCCAA pLKO.1 1621 CDS 100% 2.640 1.848 N INTS7 n/a
16 TRCN0000156022 CAGCCCATGCTGATAGTGAAT pLKO.1 2286 CDS 100% 4.950 2.970 N INTS7 n/a
17 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 3155 3UTR 100% 4.950 2.475 Y ERAP2 n/a
18 TRCN0000155229 GATCAAGACCATCCTGGCTAA pLKO.1 3205 3UTR 100% 4.050 2.025 Y INTS7 n/a
19 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3156 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199809.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07959 pDONR223 99.6% 94.8% 94.8% None 223_224ins147;1127A>G n/a
2 ccsbBroad304_07959 pLX_304 0% 94.8% 94.8% V5 (not translated due to prior stop codon) 223_224ins147;1127A>G n/a
3 ccsbBroadEn_15774 pDONR223 0% 93.4% 93.3% None 223_224ins147;1127A>G;2127_2168del n/a
4 ccsbBroad304_15774 pLX_304 0% 93.4% 93.3% V5 223_224ins147;1127A>G;2127_2168del n/a
5 TRCN0000465262 GATGGAACCCTTTCTCTATATGGT pLX_317 9.6% 93.4% 93.3% V5 223_224ins147;1127A>G;2127_2168del n/a
Download CSV