Transcript: Human NM_001331133.1

Homo sapiens zinc finger protein 253 (ZNF253), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
ZNF253 (56242)
Length:
2299
CDS:
233..1540

Additional Resources:

NCBI RefSeq record:
NM_001331133.1
NBCI Gene record:
ZNF253 (56242)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001331133.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418521 GAGTTTATATGGAACACAAAC pLKO_005 1620 3UTR 100% 10.800 7.560 N ZNF253 n/a
2 TRCN0000416691 CACGTTACCACACATAAGAAA pLKO_005 932 CDS 100% 5.625 3.938 N ZNF253 n/a
3 TRCN0000021814 CCTTTAACTATGGAAAGACAT pLKO.1 224 5UTR 100% 4.950 3.465 N ZNF253 n/a
4 TRCN0000021817 CCCAGTTATGAGTTCTCATTT pLKO.1 262 CDS 100% 13.200 7.920 N ZNF253 n/a
5 TRCN0000021818 CATAGTGAAGAATGTGACAGA pLKO.1 1480 CDS 100% 2.640 1.584 N ZNF253 n/a
6 TRCN0000254729 TTAAGAGACATGGCGATAATT pLKO_005 2123 3UTR 100% 15.000 7.500 Y ZNF506 n/a
7 TRCN0000239639 CAGGAGAGAAACCCTACAAAT pLKO_005 1044 CDS 100% 13.200 6.600 Y Zfp992 n/a
8 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 792 CDS 100% 13.200 6.600 Y Zfp934 n/a
9 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 792 CDS 100% 13.200 6.600 Y 2810408B13Rik n/a
10 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 792 CDS 100% 13.200 6.600 Y EG668616 n/a
11 TRCN0000435505 ACCCTACAAATGTGATGAATG pLKO_005 1222 CDS 100% 10.800 5.400 Y ZNF678 n/a
12 TRCN0000146802 CCTCAAACCTTACTACACATA pLKO.1 759 CDS 100% 4.950 2.475 Y ZNF714 n/a
13 TRCN0000021816 CTGGAGAGAAACCTTACAGAT pLKO.1 624 CDS 100% 4.950 2.475 Y ZNF253 n/a
14 TRCN0000155654 CTGGAGAGAAACCTTACAGAT pLKO.1 624 CDS 100% 4.950 2.475 Y ZNF320 n/a
15 TRCN0000147367 GAATGTGATGAATGTGGGAAA pLKO.1 1564 3UTR 100% 4.050 2.025 Y ZNF658B n/a
16 TRCN0000236731 ACCTTACTACACATAAGATAA pLKO_005 849 CDS 100% 13.200 6.600 Y ZNF98 n/a
17 TRCN0000243782 TGGAGAGAAACCCTATGAATA pLKO_005 1548 3UTR 100% 13.200 6.600 Y Zfp977 n/a
18 TRCN0000284648 ATACAGGAGAGAAACCCTATA pLKO_005 1041 CDS 100% 10.800 5.400 Y Gm14308 n/a
19 TRCN0000158848 GAGAAACCTTACAAATGTGAT pLKO.1 1385 CDS 100% 4.950 2.475 Y ZNF28 n/a
20 TRCN0000107758 TGTCTCTAAGCCAGACCTGAT pLKO.1 178 5UTR 100% 4.050 2.025 Y ZNF273 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001331133.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12296 pDONR223 100% 97.2% 97.2% None 1_36del n/a
2 TRCN0000478211 CAAATCTCTGTTGACCAGACGGTG pLX_317 19.4% 97.2% 97.2% V5 1_36del n/a
3 ccsbBroadEn_08635 pDONR223 100% 87% 87.1% None 0_1ins192;813A>T;825C>T n/a
4 ccsbBroad304_08635 pLX_304 0% 87% 87.1% V5 0_1ins192;813A>T;825C>T n/a
5 TRCN0000469248 TACCCGCTTGGCTTTAAAAACCAA pLX_317 37.7% 64.7% 64.7% V5 0_1ins192;795_1130del n/a
6 ccsbBroadEn_09302 pDONR223 100% 65.4% 54.4% None (many diffs) n/a
7 ccsbBroad304_09302 pLX_304 0% 65.4% 54.4% V5 (many diffs) n/a
8 TRCN0000478136 TCTGGATTCCTTTAAAAGGATTTC pLX_317 23% 65.4% 54.4% V5 (many diffs) n/a
Download CSV