Transcript: Human NM_001351777.1

Homo sapiens zinc finger protein 320 (ZNF320), transcript variant 6, mRNA.

Source:
NCBI, updated 2018-07-01
Taxon:
Homo sapiens (human)
Gene:
ZNF320 (162967)
Length:
5148
CDS:
239..592

Additional Resources:

NCBI RefSeq record:
NM_001351777.1
NBCI Gene record:
ZNF320 (162967)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001351777.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021905 GACGTGATGCTGGAGAATTAT pLKO.1 341 CDS 100% 15.000 7.500 Y ZNF765 n/a
2 TRCN0000021906 CCCTGCTCAGAGGACTCTATA pLKO.1 316 CDS 100% 13.200 6.600 Y ZNF765 n/a
3 TRCN0000021908 TCAGGGATGTGGCCATAGAAT pLKO.1 267 CDS 100% 5.625 2.813 Y ZNF765 n/a
4 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 4429 3UTR 100% 4.950 2.475 Y ERAP2 n/a
5 TRCN0000015885 GCAATTCATACTGGAGAGAAA pLKO.1 1760 3UTR 100% 4.950 2.475 Y ZNF702P n/a
6 TRCN0000012914 GCGAACTCATACTGGAGAGAA pLKO.1 2586 3UTR 100% 4.950 2.475 Y ZNF137P n/a
7 TRCN0000129445 GACTTCCAAAGTGCTGGGATT pLKO.1 1258 3UTR 100% 4.050 2.025 Y PACRGL n/a
8 TRCN0000021907 GCTGGAGAATTATAGGAACCT pLKO.1 349 CDS 100% 2.640 1.320 Y ZNF765 n/a
9 TRCN0000165704 CAATGGCACAATCTTGGCTCA pLKO.1 4059 3UTR 100% 2.160 1.080 Y LOC652276 n/a
10 TRCN0000162795 CTTCCAAAGTGCTGGGATTAT pLKO.1 1260 3UTR 100% 13.200 6.600 Y SLC48A1 n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3019 3UTR 100% 13.200 6.600 Y LIAS n/a
12 TRCN0000147979 GCAATTCATACTGGAGAGAAT pLKO.1 1760 3UTR 100% 4.950 2.475 Y ZNF321P n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001351777.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14339 pDONR223 100% 45.6% 2.5% None (many diffs) n/a
2 ccsbBroad304_14339 pLX_304 0% 45.6% 2.5% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000478280 ACGAGTTCACTGTCATGACCAACC pLX_317 100% 45.6% 2.5% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_05120 pDONR223 100% 18.2% 11.7% None (many diffs) n/a
5 ccsbBroad304_05120 pLX_304 0% 18.2% 11.7% V5 (many diffs) n/a
6 TRCN0000475531 CGCGGTATGATTAGCATATCCGAT pLX_317 14.1% 18.2% 11.7% V5 (many diffs) n/a
7 ccsbBroadEn_04800 pDONR223 100% 8.3% 6.3% None (many diffs) n/a
8 ccsbBroad304_04800 pLX_304 0% 8.3% 6.3% V5 (many diffs) n/a
9 TRCN0000478315 CGTGCCTTGTCGAAGCCACGTTAA pLX_317 18.1% 8.3% 6.3% V5 (many diffs) n/a
Download CSV