Transcript: Human NM_001364731.1

Homo sapiens zinc finger protein 69 (ZNF69), transcript variant 4, mRNA.

Source:
NCBI, updated 2018-07-03
Taxon:
Homo sapiens (human)
Gene:
ZNF69 (7620)
Length:
2399
CDS:
143..1801

Additional Resources:

NCBI RefSeq record:
NM_001364731.1
NBCI Gene record:
ZNF69 (7620)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001364731.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148059 GCCTATGAGTATCAGGAATAT pLKO.1 557 CDS 100% 13.200 7.920 N ZNF69 n/a
2 TRCN0000147547 GAAACTCTACAAGGAAGTGAT pLKO.1 238 CDS 100% 4.950 2.970 N ZNF69 n/a
3 TRCN0000149207 GTATCAGGAATATGGACCGAA pLKO.1 565 CDS 100% 2.640 1.584 N ZNF69 n/a
4 TRCN0000218427 ACTGGAGAGAAACCCTATAAA pLKO_005 1685 CDS 100% 15.000 7.500 Y ZNF443 n/a
5 TRCN0000374174 ACTGGAGAGAAACCCTATAAA pLKO_005 1685 CDS 100% 15.000 7.500 Y Zfp97 n/a
6 TRCN0000243739 GAATGTAAACAATGTGGTAAA pLKO_005 845 CDS 100% 10.800 5.400 Y Gm14411 n/a
7 TRCN0000149143 GAGAAACTTCAGGAGTCTCAT pLKO.1 340 CDS 100% 4.950 2.475 Y ZNF69 n/a
8 TRCN0000149677 GATGCTGGAAACTTTCAGGAA pLKO.1 256 CDS 100% 2.640 1.320 Y ZNF69 n/a
9 TRCN0000156989 GCTGGAAACTTTCAGGAACCT pLKO.1 259 CDS 100% 2.640 1.320 Y ZNF763 n/a
10 TRCN0000016371 GCTGGATATTTCCCAGAGGAA pLKO.1 220 CDS 100% 2.640 1.320 Y ZNF440 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001364731.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15236 pDONR223 77.6% 84.8% 70.9% None (many diffs) n/a
2 ccsbBroad304_15236 pLX_304 0% 84.8% 70.9% V5 (many diffs) n/a
3 TRCN0000471005 ACATCAGGGGTCAATTGTCCTCTC pLX_317 27.5% 75.8% 70.6% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_15207 pDONR223 64.2% 60.1% 53.4% None (many diffs) n/a
5 ccsbBroad304_15207 pLX_304 0% 60.1% 53.4% V5 (many diffs) n/a
6 TRCN0000479573 TCAACGTGAACCTTCGTTCCTCGT pLX_317 53.6% 36.9% 34.4% V5 (not translated due to frame shift) (many diffs) n/a
7 ccsbBroadEn_01804 pDONR223 100% 26.9% 26.9% None 448_1656del n/a
8 ccsbBroad304_01804 pLX_304 0% 26.9% 26.9% V5 448_1656del n/a
Download CSV