Transcript: Human NM_022048.5

Homo sapiens casein kinase 1 gamma 1 (CSNK1G1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
CSNK1G1 (53944)
Length:
8085
CDS:
411..1679

Additional Resources:

NCBI RefSeq record:
NM_022048.5
NBCI Gene record:
CSNK1G1 (53944)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022048.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196979 GATTGGGTTGGGAGACCTATT pLKO.1 1389 CDS 100% 10.800 15.120 N CSNK1G1 n/a
2 TRCN0000010608 TGACCGAACATTTACTTTGAA pLKO.1 806 CDS 100% 5.625 7.875 N CSNK1G1 n/a
3 TRCN0000276720 TACTTTGAAGACGGTGTTAAT pLKO_005 818 CDS 100% 13.200 10.560 N Csnk1g1 n/a
4 TRCN0000197037 GAACCTCATTTACCGAGATGT pLKO.1 884 CDS 100% 4.950 3.960 N CSNK1G1 n/a
5 TRCN0000196493 GCATATTGTGTCTGGTTATAT pLKO.1 2473 3UTR 100% 15.000 10.500 N CSNK1G1 n/a
6 TRCN0000276655 CTCAACCCTCTCCAGCATAAA pLKO_005 2043 3UTR 100% 13.200 9.240 N Csnk1g1 n/a
7 TRCN0000194859 CTTTGCCCATTGTACTCTTAA pLKO.1 7376 3UTR 100% 13.200 9.240 N CSNK1G1 n/a
8 TRCN0000196630 GCTAACTTACTGTATAGAAAG pLKO.1 3996 3UTR 100% 10.800 7.560 N CSNK1G1 n/a
9 TRCN0000010607 CCTTTGACTATGCCTATGATT pLKO.1 1372 CDS 100% 5.625 3.938 N CSNK1G1 n/a
10 TRCN0000010610 AGCAATCAAACTGGAACCAAT pLKO.1 620 CDS 100% 4.950 3.465 N CSNK1G1 n/a
11 TRCN0000010609 GATGGCAACCTACCTTCGATA pLKO.1 1265 CDS 100% 4.950 3.465 N CSNK1G1 n/a
12 TRCN0000023800 CCTTCGATATGTCAGGCGATT pLKO.1 1277 CDS 100% 4.050 5.670 N Csnk1g1 n/a
13 TRCN0000276719 CCTTCGATATGTCAGGCGATT pLKO_005 1277 CDS 100% 4.050 5.670 N Csnk1g1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022048.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03398 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03398 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000491660 CTATAGACTCCTGTTCTGCAACTT pLX_317 31.7% 100% 100% V5 n/a
4 TRCN0000488866 ATGTACATGCCGCGAATCAACAAC pLX_317 27.8% 90.7% 87.9% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000488064 TTCGGGGAGCAGCTCCGAAACTCT pLX_317 27.1% 90.6% 87.9% V5 (many diffs) n/a
6 TRCN0000489732 TAATGTCAATGTAAAACACCATGT pLX_317 37.4% 82% 53.5% V5 (not translated due to prior stop codon) (many diffs) n/a
7 ccsbBroadEn_15079 pDONR223 0% 72.7% 72.7% None 1_345del n/a
8 ccsbBroad304_15079 pLX_304 0% 72.7% 72.7% V5 1_345del n/a
9 TRCN0000479811 TTGCCCCCTAACCCCGCCATAGCT pLX_317 43.4% 72.7% 72.7% V5 1_345del n/a
10 ccsbBroadEn_14160 pDONR223 100% 72.6% 72.5% None 1_345del;1256A>C n/a
11 ccsbBroad304_14160 pLX_304 0% 72.6% 72.5% V5 1_345del;1256A>C n/a
12 TRCN0000472649 GAGTTCCTTCAATCACTAGGGTAA pLX_317 40.3% 72.6% 72.5% V5 1_345del;1256A>C n/a
Download CSV