Transcript: Human NM_153498.4

Homo sapiens calcium/calmodulin dependent protein kinase ID (CAMK1D), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
CAMK1D (57118)
Length:
8088
CDS:
273..1430

Additional Resources:

NCBI RefSeq record:
NM_153498.4
NBCI Gene record:
CAMK1D (57118)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001144895 TATGGGAGACCTACCAGAGT pXPR_003 CGG 751 65% 7 0.9161 CAMK1D CAMK1D 77443
2 BRDN0001145707 GATGTAGGCAATCACTCCGA pXPR_003 TGG 622 54% 6 0.6943 CAMK1D CAMK1D 77444
3 BRDN0001146044 GGTCCCCACTTACGTTCCGA pXPR_003 GGG 88 8% 1 0.3247 CAMK1D CAMK1D 77445
4 BRDN0001148035 TTTGGATTGTCAAAAATGGA pXPR_003 GGG 512 44% 5 -0.9654 CAMK1D CAMK1D 77442
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_153498.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197282 GCCGTCCTGAGAAAGATTAAG pLKO.1 483 CDS 100% 13.200 18.480 N CAMK1D n/a
2 TRCN0000352651 GCCGTCCTGAGAAAGATTAAG pLKO_005 483 CDS 100% 13.200 18.480 N CAMK1D n/a
3 TRCN0000195531 CGGAGTGATTGCCTACATCTT pLKO.1 893 CDS 100% 4.950 6.930 N CAMK1D n/a
4 TRCN0000342579 CGGAGTGATTGCCTACATCTT pLKO_005 893 CDS 100% 4.950 6.930 N CAMK1D n/a
5 TRCN0000195715 CAGATCCTCAAGGCGGAATAT pLKO.1 966 CDS 100% 13.200 9.240 N CAMK1D n/a
6 TRCN0000001756 TGATGGAGAAGGACCCGAATA pLKO.1 1048 CDS 100% 10.800 7.560 N CAMK1D n/a
7 TRCN0000342628 TGATGGAGAAGGACCCGAATA pLKO_005 1048 CDS 100% 10.800 7.560 N CAMK1D n/a
8 TRCN0000001755 AGAGCTGTTTGACCGGATAGT pLKO.1 584 CDS 100% 4.950 3.465 N CAMK1D n/a
9 TRCN0000342578 AGAGCTGTTTGACCGGATAGT pLKO_005 584 CDS 100% 4.950 3.465 N CAMK1D n/a
10 TRCN0000197125 GACTTCATTCGGAACCTGATG pLKO.1 1032 CDS 100% 4.050 2.835 N CAMK1D n/a
11 TRCN0000001752 TGCTGTGAAGTGTATCCCTAA pLKO.1 419 CDS 100% 4.050 2.835 N CAMK1D n/a
12 TRCN0000001754 AGGCGGAATATGAGTTTGACT pLKO.1 976 CDS 100% 3.000 2.100 N CAMK1D n/a
13 TRCN0000342580 AGGCGGAATATGAGTTTGACT pLKO_005 976 CDS 100% 3.000 2.100 N CAMK1D n/a
14 TRCN0000001753 AGAATGAGATAGCCGTCCTGA pLKO.1 472 CDS 100% 2.640 1.848 N CAMK1D n/a
15 TRCN0000179121 CATGGTGAAACCCTGTTTCTA pLKO.1 5464 3UTR 100% 5.625 2.813 Y LOC339059 n/a
16 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 5461 3UTR 100% 4.950 2.475 Y LOC339059 n/a
17 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3489 3UTR 100% 4.950 2.475 Y KAAG1 n/a
18 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 2179 3UTR 100% 10.800 5.400 Y SMIM11A n/a
19 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 5553 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153498.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08703 pDONR223 100% 99.9% 100% None 948C>G n/a
2 ccsbBroad304_08703 pLX_304 0% 99.9% 100% V5 948C>G n/a
3 TRCN0000472635 AAAGGACCTGACCAGAGAAGTGCC pLX_317 33.2% 99.9% 100% V5 948C>G n/a
4 ccsbBroadEn_15118 pDONR223 0% 99.9% 100% None 948C>G n/a
5 ccsbBroad304_15118 pLX_304 0% 99.9% 100% V5 948C>G n/a
6 TRCN0000468350 TATCTGAATCAGCCTGATTTTGGG pLX_317 33.2% 99.9% 100% V5 948C>G n/a
7 TRCN0000489121 ACCATGACATTCTAAAGTACAACG pLX_317 28.3% 90.9% 89.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV