Transcript: Human NR_003669.2

Homo sapiens metallothionein 1I, pseudogene (MT1IP), transcript variant 1, non-coding RNA.

Source:
NCBI, updated 2018-05-09
Taxon:
Homo sapiens (human)
Gene:
MT1IP (644314)
Length:
372
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_003669.2
NBCI Gene record:
MT1IP (644314)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_003669.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242660 GCAAATGCACCTCCTGCAAGA pLKO_005 123 3UTR 100% 4.050 2.025 Y MT1H n/a
2 TRCN0000364944 TGCAAATGCACCTCCTGCAAG pLKO_005 122 3UTR 100% 4.050 2.025 Y MT1E n/a
3 TRCN0000072611 CAAATGCACCTCCTGCAAGAA pLKO.1 124 3UTR 100% 4.950 2.475 Y MT1F n/a
4 TRCN0000155121 CAAATGCACCTCCTGCAAGAA pLKO.1 124 3UTR 100% 4.950 2.475 Y MT1X n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_003669.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01044 pDONR223 100% 36.7% None (many diffs) n/a
2 ccsbBroad304_01044 pLX_304 0% 36.7% V5 (many diffs) n/a
3 TRCN0000475214 ATCGACCACCTTCTCGGATCAACG pLX_317 100% 36.7% V5 (many diffs) n/a
4 ccsbBroadEn_01042 pDONR223 100% 36.7% None (many diffs) n/a
5 ccsbBroad304_01042 pLX_304 0% 36.7% V5 (many diffs) n/a
6 TRCN0000470527 TTTTTAACCATTGCTGGCACAAAG pLX_317 100% 36.7% V5 (many diffs) n/a
7 ccsbBroadEn_01041 pDONR223 100% 36.7% None (many diffs) n/a
8 ccsbBroad304_01041 pLX_304 95.5% 36.7% V5 (many diffs) n/a
9 ccsbBroadEn_01043 pDONR223 100% 36.7% None (many diffs) n/a
10 ccsbBroad304_01043 pLX_304 0% 36.7% V5 (many diffs) n/a
11 ccsbBroadEn_01045 pDONR223 100% 36.4% None (many diffs) n/a
12 ccsbBroad304_01045 pLX_304 0% 36.4% V5 (many diffs) n/a
13 TRCN0000472152 TGCCGATATAGCTCTCTATACTCA pLX_317 100% 36.4% V5 (many diffs) n/a
14 ccsbBroadEn_01040 pDONR223 100% 36.4% None (many diffs) n/a
15 ccsbBroad304_01040 pLX_304 0% 36.4% V5 (many diffs) n/a
16 TRCN0000465872 GTAGAGTCACTGCCTTGTCCTAGG pLX_317 100% 36.4% V5 (many diffs) n/a
17 ccsbBroadEn_06598 pDONR223 100% 36.2% None (many diffs) n/a
18 ccsbBroad304_06598 pLX_304 0% 36.2% V5 (many diffs) n/a
19 TRCN0000473594 TGCAAGCTAGAGCAGCCGCGTATG pLX_317 100% 36.2% V5 (many diffs) n/a
20 ccsbBroadEn_13207 pDONR223 100% 35.7% None (many diffs) n/a
21 ccsbBroad304_13207 pLX_304 0% 35.7% V5 (many diffs) n/a
22 TRCN0000467056 AGATTTTCATGCAACTTTTCTCGA pLX_317 100% 35.7% V5 (many diffs) n/a
23 ccsbBroadEn_01039 pDONR223 100% 35.6% None (many diffs) n/a
24 ccsbBroad304_01039 pLX_304 0% 35.6% V5 (many diffs) n/a
25 TRCN0000468729 CAAAATATTAAAACTGATCGTATT pLX_317 100% 35.6% V5 (many diffs) n/a
26 ccsbBroadEn_10353 pDONR223 100% 28.4% None (many diffs) n/a
27 ccsbBroad304_10353 pLX_304 0% 28.4% V5 (many diffs) n/a
28 TRCN0000473861 CGCCCGCAGATCATTCGATACGCC pLX_317 100% 28.4% V5 (many diffs) n/a
Download CSV