Transcript: Human NR_138052.2

Homo sapiens zinc finger protein 431 (ZNF431), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
ZNF431 (170959)
Length:
8697
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_138052.2
NBCI Gene record:
ZNF431 (170959)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_138052.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000016484 CCGCAAGTGTAGATGAGTATA pLKO.1 657 3UTR 100% 13.200 18.480 N ZNF431 n/a
2 TRCN0000016485 GTGAAGAATGTGACAATACAT pLKO.1 1839 3UTR 100% 5.625 3.938 N ZNF431 n/a
3 TRCN0000016487 CCCAGCTATGTGTTCTTATTT pLKO.1 529 3UTR 100% 15.000 9.000 N ZNF431 n/a
4 TRCN0000016486 CCCACAACTTACTGCACATAA pLKO.1 1534 3UTR 100% 13.200 7.920 N ZNF431 n/a
5 TRCN0000016483 GCTGAGAGGAATCTTCTAGTT pLKO.1 149 3UTR 100% 4.950 2.970 N ZNF431 n/a
6 TRCN0000430017 CCAGTCCTCAAACCTTATTAA pLKO_005 1864 3UTR 100% 15.000 7.500 Y ZNF431 n/a
7 TRCN0000427608 GTGCACAAAGAAGGTTATAAT pLKO_005 680 3UTR 100% 15.000 7.500 Y ZNF431 n/a
8 TRCN0000236731 ACCTTACTACACATAAGATAA pLKO_005 1119 3UTR 100% 13.200 6.600 Y ZNF98 n/a
9 TRCN0000236730 CCCTTACTACACATAAGATAA pLKO_005 1035 3UTR 100% 13.200 6.600 Y ZNF98 n/a
10 TRCN0000204533 CCTCCCAAAGTGCTGGAATTA pLKO.1 5064 3UTR 100% 13.200 6.600 Y LRRC74B n/a
11 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 1230 3UTR 100% 13.200 6.600 Y Zfp934 n/a
12 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 1230 3UTR 100% 13.200 6.600 Y 2810408B13Rik n/a
13 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 1230 3UTR 100% 13.200 6.600 Y EG668616 n/a
14 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 3902 3UTR 100% 13.200 6.600 Y IQCC n/a
15 TRCN0000060503 CCTCTCAAGTAGCTGGGATTA pLKO.1 3425 3UTR 100% 10.800 5.400 Y NCCRP1 n/a
16 TRCN0000155576 CCTCTCAAGTAGCTGGGATTA pLKO.1 3425 3UTR 100% 10.800 5.400 Y KLHL30 n/a
17 TRCN0000165697 CCTCTCAAGTAGCTGGGATTA pLKO.1 3425 3UTR 100% 10.800 5.400 Y SLC48A1 n/a
18 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 3836 3UTR 100% 4.950 2.475 Y CFLAR n/a
19 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 3836 3UTR 100% 4.950 2.475 Y C19orf31 n/a
20 TRCN0000016346 CACTGGAGAGAAACCCTACAA pLKO.1 1648 3UTR 100% 4.950 2.475 Y ZNF254 n/a
21 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 2076 3UTR 100% 4.950 2.475 Y ORAI2 n/a
22 TRCN0000183765 CCCTCAATTCTTAACAGACAT pLKO.1 2324 3UTR 100% 4.950 2.475 Y ZNF714 n/a
23 TRCN0000017702 CCCTGGAATATGAAGAGACAT pLKO.1 491 3UTR 100% 4.950 2.475 Y ZNF430 n/a
24 TRCN0000146802 CCTCAAACCTTACTACACATA pLKO.1 1449 3UTR 100% 4.950 2.475 Y ZNF714 n/a
25 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 5910 3UTR 100% 4.950 2.475 Y ERAP2 n/a
26 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 5911 3UTR 100% 13.200 6.600 Y LIAS n/a
27 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 7346 3UTR 100% 5.625 2.813 Y KLHL30 n/a
28 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 2073 3UTR 100% 4.950 2.475 Y LOC339059 n/a
29 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 3834 3UTR 100% 4.950 2.475 Y ERN2 n/a
30 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 3834 3UTR 100% 4.950 2.475 Y P3H4 n/a
31 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 3834 3UTR 100% 4.950 2.475 Y P3H4 n/a
32 TRCN0000158848 GAGAAACCTTACAAATGTGAT pLKO.1 1571 3UTR 100% 4.950 2.475 Y ZNF28 n/a
33 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 7346 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_138052.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09784 pDONR223 100% 19.8% None (many diffs) n/a
2 ccsbBroad304_09784 pLX_304 0% 19.8% V5 (many diffs) n/a
3 TRCN0000478115 ATTTTTATATATACCACTCGGCCC pLX_317 19.7% 19.8% V5 (many diffs) n/a
4 ccsbBroadEn_15167 pDONR223 53.6% 17.3% None (many diffs) n/a
5 ccsbBroad304_15167 pLX_304 0% 17.3% V5 (not translated due to prior stop codon) (many diffs) n/a
6 ccsbBroadEn_15278 pDONR223 59.5% 17.2% None (many diffs) n/a
7 ccsbBroad304_15278 pLX_304 0% 17.2% V5 (many diffs) n/a
8 ccsbBroadEn_15273 pDONR223 50.9% 16.3% None (many diffs) n/a
9 ccsbBroad304_15273 pLX_304 0% 16.3% V5 (many diffs) n/a
10 TRCN0000472761 GCGGTTCAATGTTGTAGTCTTGTG pLX_317 63.8% 7.8% V5 (not translated due to frame shift) (many diffs) n/a
11 ccsbBroadEn_11384 pDONR223 100% 2.7% None (many diffs) n/a
12 ccsbBroad304_11384 pLX_304 0% 2.7% V5 (many diffs) n/a
13 TRCN0000470576 TACATACAGACCTACACGTAGACC pLX_317 100% 2.7% V5 (many diffs) n/a
14 ccsbBroadEn_13746 pDONR223 100% 2.3% None (many diffs) n/a
15 ccsbBroad304_13746 pLX_304 0% 2.3% V5 (many diffs) n/a
16 TRCN0000475669 ATTCGCAGCGAGTTTGTCCGCCGC pLX_317 100% 2.3% V5 (many diffs) n/a
Download CSV