Transcript: Mouse NM_001347144.1

Mus musculus mitogen-activated protein kinase kinase 2 (Map2k2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Map2k2 (26396)
Length:
2416
CDS:
233..1435

Additional Resources:

NCBI RefSeq record:
NM_001347144.1
NBCI Gene record:
Map2k2 (26396)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001347144.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000025225 CTTCCAGGAGTTTGTGAATAA pLKO.1 1255 CDS 100% 13.200 9.240 N Map2k2 n/a
2 TRCN0000295523 CTTCCAGGAGTTTGTGAATAA pLKO_005 1255 CDS 100% 13.200 9.240 N Map2k2 n/a
3 TRCN0000025226 CAAGCGGATTCCTGAAGACAT pLKO.1 718 CDS 100% 4.950 3.465 N Map2k2 n/a
4 TRCN0000055064 CCACCTGATGCCAAGGAACTA pLKO.1 1037 CDS 100% 4.950 3.465 N Map2k2 n/a
5 TRCN0000288077 CCACCTGATGCCAAGGAACTA pLKO_005 1037 CDS 100% 4.950 3.465 N Map2k2 n/a
6 TRCN0000025227 GCTGCTGGACTACATAGTGAA pLKO.1 1192 CDS 100% 4.950 3.465 N Map2k2 n/a
7 TRCN0000307557 GCTGCTGGACTACATAGTGAA pLKO_005 1192 CDS 100% 4.950 3.465 N Map2k2 n/a
8 TRCN0000055067 CTTCCTTACCCAGAAGGCTAA pLKO.1 400 CDS 100% 4.050 2.835 N Map2k2 n/a
9 TRCN0000055063 CGACTTTGAGAGGATCTCAGA pLKO.1 442 CDS 100% 2.640 1.848 N Map2k2 n/a
10 TRCN0000288152 CGACTTTGAGAGGATCTCAGA pLKO_005 442 CDS 100% 2.640 1.848 N Map2k2 n/a
11 TRCN0000055065 CCTCCGAGAGAAGCACCAGAT pLKO.1 781 CDS 100% 1.350 0.945 N Map2k2 n/a
12 TRCN0000288078 CCTCCGAGAGAAGCACCAGAT pLKO_005 781 CDS 100% 1.350 0.945 N Map2k2 n/a
13 TRCN0000025224 GCCCTCCAACATCCTGGTGAA pLKO.1 820 CDS 100% 1.350 0.945 N Map2k2 n/a
14 TRCN0000025228 GCTGCTGATGAACCACGCCTT pLKO.1 1315 CDS 100% 0.720 0.504 N Map2k2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347144.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14808 pDONR223 0% 87.2% 94.2% None (many diffs) n/a
2 ccsbBroad304_14808 pLX_304 0% 87.2% 94.2% V5 (many diffs) n/a
3 TRCN0000465915 AACCGTCGGGCCCACCATGAAATT pLX_317 17.9% 87.2% 94.2% V5 (many diffs) n/a
4 TRCN0000488054 AAGGTTTGCCGATAAATCTTAGCG pLX_317 23.1% 87.2% 94.2% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000487985 AGCCCTCCCGCTAGCATAACCTAG pLX_317 26.4% 87.1% 94% V5 (many diffs) n/a
6 TRCN0000465689 TGACCGAAAAAAAATTTTTCGTTT pLX_317 17.9% 86.9% 66.4% V5 (not translated due to prior stop codon) (many diffs) n/a
7 ccsbBroadEn_10634 pDONR223 100% 81.6% 85% None (many diffs) n/a
8 ccsbBroad304_10634 pLX_304 0% 81.6% 85% V5 (many diffs) n/a
9 TRCN0000477744 AAGCGGTCACCAGAATGAGGGTTC pLX_317 27.6% 81.6% 85% V5 (many diffs) n/a
10 TRCN0000487698 GCGCTTTTCCTGCACCTTGACTTA pLX_317 23.3% 67.6% 72.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV