Transcript: Human NR_163905.1

Homo sapiens protein disulfide isomerase family A member 4 (PDIA4), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-07-02
Taxon:
Homo sapiens (human)
Gene:
PDIA4 (9601)
Length:
3116
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_163905.1
NBCI Gene record:
PDIA4 (9601)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_163905.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049334 CCTGAGAGAAGATTACAAATT pLKO.1 1422 3UTR 100% 13.200 18.480 N PDIA4 n/a
2 TRCN0000289674 CCTGAGAGAAGATTACAAATT pLKO_005 1422 3UTR 100% 13.200 18.480 N PDIA4 n/a
3 TRCN0000049336 GCAAGGTGTCAAACGATGCTA pLKO.1 1634 3UTR 100% 3.000 4.200 N PDIA4 n/a
4 TRCN0000307107 GCAAGGTGTCAAACGATGCTA pLKO_005 1634 3UTR 100% 3.000 4.200 N PDIA4 n/a
5 TRCN0000049337 CTTGGTCCTAAATGATGCAAA pLKO.1 627 3UTR 100% 4.950 3.465 N PDIA4 n/a
6 TRCN0000289676 CTTGGTCCTAAATGATGCAAA pLKO_005 627 3UTR 100% 4.950 3.465 N PDIA4 n/a
7 TRCN0000111779 GCTAACAACCTGAGAGAAGAT pLKO.1 1414 3UTR 100% 4.950 3.465 N Pdia4 n/a
8 TRCN0000316228 GCTAACAACCTGAGAGAAGAT pLKO_005 1414 3UTR 100% 4.950 3.465 N Pdia4 n/a
9 TRCN0000049335 CCAAGAAGTACAAGGGCCAAA pLKO.1 2141 3UTR 100% 4.050 2.835 N PDIA4 n/a
10 TRCN0000049333 GCTTGTGTTGACCAAAGAGAA pLKO.1 972 3UTR 100% 4.950 2.970 N PDIA4 n/a
11 TRCN0000289675 GCTTGTGTTGACCAAAGAGAA pLKO_005 972 3UTR 100% 4.950 2.970 N PDIA4 n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 420 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 420 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_163905.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02208 pDONR223 100% 62% None 1_97del;185_522del;2371_3116del n/a
2 ccsbBroad304_02208 pLX_304 0% 62% V5 1_97del;185_522del;2371_3116del n/a
3 TRCN0000466550 TCCGAAGTCGGTAGATTGACGGCG pLX_317 15.7% 62% V5 1_97del;185_522del;2371_3116del n/a
4 ccsbBroadEn_13781 pDONR223 100% 7.7% None (many diffs) n/a
5 ccsbBroad304_13781 pLX_304 0% 7.7% V5 (many diffs) n/a
6 TRCN0000469746 TCCCTGCGCCGTCCGGGTTTTCGA pLX_317 100% 7.7% V5 (many diffs) n/a
7 ccsbBroadEn_10792 pDONR223 100% 6.8% None (many diffs) n/a
8 ccsbBroad304_10792 pLX_304 0% 6.8% V5 (many diffs) n/a
9 TRCN0000472287 GCCTGGAGAGCTTTCCTCGTCACG pLX_317 100% 6.8% V5 (many diffs) n/a
10 ccsbBroadEn_12783 pDONR223 100% 6% None (many diffs) n/a
11 ccsbBroad304_12783 pLX_304 0% 6% V5 (many diffs) n/a
12 TRCN0000478282 TATCTGCTCCACCGGGCTCCGTTG pLX_317 100% 6% V5 (many diffs) n/a
13 ccsbBroadEn_11616 pDONR223 100% 5.4% None (many diffs) n/a
14 ccsbBroad304_11616 pLX_304 0% 5.4% V5 (many diffs) n/a
15 TRCN0000467678 CCTCCCCTCACACCTCGTCAAAAC pLX_317 100% 5.4% V5 (many diffs) n/a
16 ccsbBroadEn_15487 pDONR223 0% 5.1% None (many diffs) n/a
17 ccsbBroad304_15487 pLX_304 0% 5.1% V5 (many diffs) n/a
18 TRCN0000473708 TAGCATCGTTGCACGCGCACGTTG pLX_317 100% 5.1% V5 (many diffs) n/a
19 ccsbBroadEn_10261 pDONR223 100% 2% None (many diffs) n/a
20 ccsbBroad304_10261 pLX_304 0% 2% V5 (many diffs) n/a
21 TRCN0000492083 TTATAGGCCCAGAGCACTACCAAC pLX_317 100% 2% V5 (many diffs) n/a
Download CSV