Transcript: Human XM_024446000.1

PREDICTED: Homo sapiens AKT serine/threonine kinase 3 (AKT3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AKT3 (10000)
Length:
1361
CDS:
39..1346

Additional Resources:

NCBI RefSeq record:
XM_024446000.1
NBCI Gene record:
AKT3 (10000)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446000.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039890 CCAAAGCCAAACACATTTATA pLKO.1 237 CDS 100% 15.000 10.500 N AKT3 n/a
2 TRCN0000039889 CCAGAGGTGTTAGAAGATAAT pLKO.1 981 CDS 100% 13.200 9.240 N AKT3 n/a
3 TRCN0000001613 GCCTCTACAACCCATCATAAA pLKO.1 441 CDS 100% 13.200 9.240 N AKT3 n/a
4 TRCN0000010185 GCCTCTACAACCCATCATAAA pLKO.1 441 CDS 100% 13.200 9.240 N AKT3 n/a
5 TRCN0000010184 GTAAACTGGCAAGATGTATAT pLKO.1 1260 CDS 100% 13.200 9.240 N AKT3 n/a
6 TRCN0000196521 GTAGTCCAACTTCACAAATTG pLKO.1 394 CDS 100% 13.200 9.240 N AKT3 n/a
7 TRCN0000001614 ACTGGCAAGATGTATATGATA pLKO.1 1264 CDS 100% 5.625 3.938 N AKT3 n/a
8 TRCN0000010187 CTGCCTTGGACTATCTACATT pLKO.1 808 CDS 100% 5.625 3.938 N AKT3 n/a
9 TRCN0000001616 AGAAACCTCAAGATGTGGATT pLKO.1 157 CDS 100% 4.950 3.465 N AKT3 n/a
10 TRCN0000054724 CTATGCTATGAAGATTCTGAA pLKO.1 557 CDS 100% 4.950 3.465 N Akt3 n/a
11 TRCN0000010181 GAAATGATGTGTGGGAGGTTA pLKO.1 1050 CDS 100% 4.950 3.465 N AKT3 n/a
12 TRCN0000055437 GAAATGATGTGTGGGAGGTTA pLKO.1 1050 CDS 100% 4.950 3.465 N AKT3 n/a
13 TRCN0000039891 GCAGAGTATTAAAGAACACTA pLKO.1 628 CDS 100% 4.950 3.465 N AKT3 n/a
14 TRCN0000022835 GCTCTTGATAAAGGATCCAAA pLKO.1 1175 CDS 100% 4.950 3.465 N Akt3 n/a
15 TRCN0000010186 TGGCACACACTCTAACTGAAA pLKO.1 607 CDS 100% 4.950 3.465 N AKT3 n/a
16 TRCN0000054725 CCGTGATCTCAAGTTGGAGAA pLKO.1 845 CDS 100% 4.050 2.835 N Akt3 n/a
17 TRCN0000196481 GACATTAAATTTCCTCGAACA pLKO.1 1122 CDS 100% 4.050 2.835 N AKT3 n/a
18 TRCN0000001615 GAAAGGGAAGAATGGACAGAA pLKO.1 318 CDS 100% 4.950 2.970 N AKT3 n/a
19 TRCN0000197265 GATGTGGATTTACCTTATCCC pLKO.1 168 CDS 100% 2.640 1.584 N AKT3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446000.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07529 pDONR223 100% 92% 91.3% None (many diffs) n/a
2 ccsbBroad304_07529 pLX_304 45.1% 92% 91.3% V5 (many diffs) n/a
3 TRCN0000473926 TGTAACGCGCAGGATGTGGCCCAG pLX_317 34.7% 92% 91.3% V5 (many diffs) n/a
4 TRCN0000489669 GCGGGCGGAAGTCATGTGCGCTCC pLX_317 28.3% 89.4% 88.9% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000487677 GGAGAAATTATCCTCAACCATTAC pLX_317 9% 89.4% 88.9% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000489678 TCCTTCGGCAATATGTCCCTGACC pLX_317 26.8% 89.3% 88.7% V5 (many diffs) n/a
7 ccsbBroadEn_14950 pDONR223 100% 88.5% 86.4% None (many diffs) n/a
8 ccsbBroad304_14950 pLX_304 35.9% 88.5% 86.4% V5 (many diffs) n/a
9 TRCN0000470264 CTGCTGTTGCGGCCGTAACAACGT pLX_317 19.2% 88.5% 86.4% V5 (many diffs) n/a
Download CSV