Transcript: Mouse XM_006514465.2

PREDICTED: Mus musculus calcium/calmodulin-dependent protein kinase II, beta (Camk2b), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Camk2b (12323)
Length:
4387
CDS:
202..2202

Additional Resources:

NCBI RefSeq record:
XM_006514465.2
NBCI Gene record:
Camk2b (12323)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001148102 CTCACCTGAGAAATTCCGTG pXPR_003 TGG 934 47% 12 -0.3666 Camk2b CAMK2B 77742
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006514465.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000012473 CCACCTTGTTATCTCCACAAA pLKO.1 4068 3UTR 100% 4.950 3.465 N Camk2b n/a
2 TRCN0000319741 CCACCTTGTTATCTCCACAAA pLKO_005 4068 3UTR 100% 4.950 3.465 N Camk2b n/a
3 TRCN0000012475 CCTGCTGAAGCATTCCAACAT pLKO.1 399 CDS 100% 4.950 3.465 N Camk2b n/a
4 TRCN0000319747 CCTGCTGAAGCATTCCAACAT pLKO_005 399 CDS 100% 4.950 3.465 N Camk2b n/a
5 TRCN0000012476 GACTGTGGAATGTCTGAAGAA pLKO.1 1059 CDS 100% 4.950 3.465 N Camk2b n/a
6 TRCN0000319748 GACTGTGGAATGTCTGAAGAA pLKO_005 1059 CDS 100% 4.950 3.465 N Camk2b n/a
7 TRCN0000012477 CTGACCTCATTTGAGCCTGAA pLKO.1 1894 CDS 100% 4.050 2.835 N Camk2b n/a
8 TRCN0000350177 CTGACCTCATTTGAGCCTGAA pLKO_005 1894 CDS 100% 4.050 2.835 N Camk2b n/a
9 TRCN0000000469 ACAAGAAAGCAGATGGAGTCA pLKO.1 1238 CDS 100% 2.640 1.848 N CAMK2B n/a
10 TRCN0000199539 CGCATGTTTGTGTCTGCCTCG pLKO.1 2276 3UTR 100% 0.400 0.280 N CAMK2B n/a
11 TRCN0000000470 ATCTCTGACATCCTGAACTCT pLKO.1 1549 CDS 100% 3.000 3.900 N CAMK2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006514465.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488486 GACCTCCTCAAGAGGCAACGCTGC pLX_317 10.9% 75.3% 80.7% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489411 AAGTGGCATAGCCCCCTCAAGCTG pLX_317 20.6% 75.3% 80.6% V5 (many diffs) n/a
3 ccsbBroadEn_14563 pDONR223 93.6% 69.5% 74.7% None (many diffs) n/a
4 ccsbBroad304_14563 pLX_304 0% 69.5% 74.7% V5 (many diffs) n/a
5 TRCN0000468031 AGCATTTCATGGTGGACCTTTAGT pLX_317 28.9% 66.8% 71.7% V5 (not translated due to frame shift) (many diffs) n/a
6 ccsbBroadEn_14564 pDONR223 0% 69.5% 74.7% None (many diffs) n/a
7 ccsbBroad304_14564 pLX_304 0% 69.5% 74.7% V5 (many diffs) n/a
8 TRCN0000480225 GACAGTGGGGGTGATCTCGGAGCG pLX_317 22.3% 69.5% 74.7% V5 (many diffs) n/a
9 ccsbBroadEn_14566 pDONR223 100% 61.7% 34.6% None (many diffs) n/a
10 ccsbBroad304_14566 pLX_304 0% 61.7% 34.6% V5 (not translated due to prior stop codon) (many diffs) n/a
11 TRCN0000480621 AAGACTGTGGCACCAACTCCCGCC pLX_317 29.4% 61.7% 34.6% V5 (not translated due to prior stop codon) (many diffs) n/a
12 TRCN0000489162 ACTTTTCATACCCTAGATACCCAC pLX_317 21.2% 58.1% 61.6% V5 (not translated due to prior stop codon) (many diffs) n/a
13 ccsbBroadEn_14562 pDONR223 100% 58% 31.2% None (many diffs) n/a
14 ccsbBroad304_14562 pLX_304 0% 58% 31.2% V5 (not translated due to prior stop codon) (many diffs) n/a
15 TRCN0000474396 TAATTGTTATTCACCCAAGAGACT pLX_317 23.8% 58% 31.2% V5 (not translated due to prior stop codon) (many diffs) n/a
16 TRCN0000489374 GACATACGTTCGACTGTGGTTCTC pLX_317 23.3% 57.9% 61.6% V5 (many diffs) n/a
Download CSV