Transcript: Human XM_017027571.1

PREDICTED: Homo sapiens zinc finger protein 430-like (LOC105372319), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LOC105372319 (105372319)
Length:
2378
CDS:
1591..2151

Additional Resources:

NCBI RefSeq record:
XM_017027571.1
NBCI Gene record:
LOC105372319 (105372319)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027571.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427608 GTGCACAAAGAAGGTTATAAT pLKO_005 1602 CDS 100% 15.000 7.500 Y ZNF431 n/a
2 TRCN0000428197 AGAATGTGGCAAAGCGTTTAA pLKO_005 2094 CDS 100% 13.200 6.600 Y ZNF678 n/a
3 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 25 5UTR 100% 5.625 2.813 Y KLHL30 n/a
4 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 25 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027571.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000469248 TACCCGCTTGGCTTTAAAAACCAA pLX_317 37.7% 41.7% 27.9% V5 (many diffs) n/a
2 ccsbBroadEn_08635 pDONR223 100% 32.3% 21.6% None (many diffs) n/a
3 ccsbBroad304_08635 pLX_304 0% 32.3% 21.6% V5 (many diffs) n/a
4 ccsbBroadEn_12296 pDONR223 100% 38.1% 25.5% None (many diffs) n/a
5 TRCN0000478211 CAAATCTCTGTTGACCAGACGGTG pLX_317 19.4% 38.1% 25.5% V5 (many diffs) n/a
6 ccsbBroadEn_09302 pDONR223 100% 34.2% 22.4% None (many diffs) n/a
7 ccsbBroad304_09302 pLX_304 0% 34.2% 22.4% V5 (many diffs) n/a
8 TRCN0000478136 TCTGGATTCCTTTAAAAGGATTTC pLX_317 23% 34.2% 22.4% V5 (many diffs) n/a
9 ccsbBroadEn_15167 pDONR223 53.6% 27.8% 23.2% None (many diffs) n/a
10 ccsbBroad304_15167 pLX_304 0% 27.8% 23.2% V5 (not translated due to prior stop codon) (many diffs) n/a
11 ccsbBroadEn_11232 pDONR223 100% 29.6% 21.1% None (many diffs) n/a
12 ccsbBroad304_11232 pLX_304 0% 29.6% 21.1% V5 (many diffs) n/a
13 TRCN0000476048 TACTATCCCAATAGAAACACCTCC pLX_317 21.8% 29.6% 21.1% V5 (many diffs) n/a
Download CSV