Transcript: Mouse XM_017320015.1

PREDICTED: Mus musculus MAP kinase-interacting serine/threonine kinase 1 (Mknk1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mknk1 (17346)
Length:
2702
CDS:
433..1440

Additional Resources:

NCBI RefSeq record:
XM_017320015.1
NBCI Gene record:
Mknk1 (17346)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320015.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000321919 TTTAGGGACGAGGCTACTTTC pLKO_005 1084 CDS 100% 10.800 15.120 N Mknk1 n/a
2 TRCN0000367984 TTGACTTCCTGCACACTAAAG pLKO_005 869 CDS 100% 10.800 8.640 N Mknk1 n/a
3 TRCN0000024430 CCGAGATGCAAACCCATGTTT pLKO.1 1597 3UTR 100% 5.625 4.500 N Mknk1 n/a
4 TRCN0000321989 CCGAGATGCAAACCCATGTTT pLKO_005 1597 3UTR 100% 5.625 4.500 N Mknk1 n/a
5 TRCN0000024429 CGAGGCTACTTTCTATGACAA pLKO.1 1092 CDS 100% 4.950 3.960 N Mknk1 n/a
6 TRCN0000321991 ATGCGGCTCTGCAGAGTATAT pLKO_005 1041 CDS 100% 13.200 9.240 N Mknk1 n/a
7 TRCN0000321990 TCACTTGTCACTTTGCATAAT pLKO_005 1851 3UTR 100% 13.200 9.240 N Mknk1 n/a
8 TRCN0000361267 AGGAAGGCAAATACGAGTTTC pLKO_005 1259 CDS 100% 10.800 7.560 N Mknk1 n/a
9 TRCN0000024433 CAGAAGCGGAAGCACTTCAAT pLKO.1 805 CDS 100% 5.625 3.938 N Mknk1 n/a
10 TRCN0000024432 CTCATCTCTAAGCTCCTGGTT pLKO.1 1321 CDS 100% 2.640 1.848 N Mknk1 n/a
11 TRCN0000024431 GAGACACTGTATCAGTGTCAA pLKO.1 682 CDS 100% 0.495 0.347 N Mknk1 n/a
12 TRCN0000141779 GACAAGAGGAGGAAGAAGAAG pLKO.1 469 CDS 100% 4.950 2.970 N ARL6IP4 n/a
13 TRCN0000006234 GCCAGGAAAGTTTGAAGATAT pLKO.1 516 CDS 100% 13.200 9.240 N MKNK1 n/a
14 TRCN0000122065 CAAGAGGAGGAAGAAGAAGAA pLKO.1 471 CDS 100% 4.950 2.970 N ARL6IP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320015.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487784 CACAGGGCATCCGCATTTATCAGC pLX_317 24.2% 74.5% 90.4% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000488574 GAGAACACTACTATTCATTTGGTT pLX_317 22.3% 70.4% 72.6% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroad304_14905 pLX_304 42.9% 63.6% 42.3% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_14905 pDONR223 100% 63.5% 42.3% None (many diffs) n/a
5 TRCN0000474479 AATATATGGTTTCTGATGTGGAAT pLX_317 29.1% 63.5% 42.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV