Transcript: Human XR_001737361.2

PREDICTED: Homo sapiens claspin (CLSPN), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CLSPN (63967)
Length:
6290
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001737361.2
NBCI Gene record:
CLSPN (63967)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001737361.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419814 ACGCGAAGCATCTTCAAATAT pLKO_005 4013 3UTR 100% 15.000 21.000 N CLSPN n/a
2 TRCN0000127921 GATGATGATAAGCGACAGCTA pLKO.1 3430 3UTR 100% 2.640 3.696 N CLSPN n/a
3 TRCN0000415371 CATGATTTCTTCAAACGTAAA pLKO_005 1051 3UTR 100% 10.800 8.640 N CLSPN n/a
4 TRCN0000419953 AGTGAGACTCAGCGCCTTATT pLKO_005 979 3UTR 100% 13.200 9.240 N CLSPN n/a
5 TRCN0000423224 GAATATGAAGAGGACGTAATT pLKO_005 3340 3UTR 100% 13.200 9.240 N CLSPN n/a
6 TRCN0000426056 GCACTATTGAAGTCATCTAAA pLKO_005 1102 3UTR 100% 13.200 9.240 N CLSPN n/a
7 TRCN0000424189 TAGCACTGAAAGTTGGAATTG pLKO_005 4095 3UTR 100% 10.800 7.560 N CLSPN n/a
8 TRCN0000129554 CCTTGCTTAGAGCTGAGTCTT pLKO.1 496 3UTR 100% 4.950 3.465 N CLSPN n/a
9 TRCN0000128461 GCAATAAGATTGCAGACAGAA pLKO.1 4155 3UTR 100% 4.950 3.465 N CLSPN n/a
10 TRCN0000434995 CAGTGAATGTGAACGTCATAG pLKO_005 1757 3UTR 100% 10.800 6.480 N CLSPN n/a
11 TRCN0000130853 GCAGACAGAAATTCCAGTGAT pLKO.1 4166 3UTR 100% 4.950 2.970 N CLSPN n/a
12 TRCN0000127922 GCCAAGAAAGTTACAGCCAAA pLKO.1 3736 3UTR 100% 4.050 2.430 N CLSPN n/a
13 TRCN0000138934 GAAGAGGAGGAGGAAGAAGAA pLKO.1 2104 3UTR 100% 4.950 2.475 Y PTMA n/a
14 TRCN0000157407 GATCTCGGCTTACTGCAACTT pLKO.1 5909 3UTR 100% 4.950 2.475 Y GTF2IRD2B n/a
15 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 4940 3UTR 100% 2.640 1.320 Y LINC01098 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001737361.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08821 pDONR223 100% 58.6% None (many diffs) n/a
2 ccsbBroad304_08821 pLX_304 0% 58.6% V5 (many diffs) n/a
3 TRCN0000479289 AGATCCGGCGTTCGCGACTTCATG pLX_317 11% 58.6% V5 (many diffs) n/a
4 ccsbBroadEn_10792 pDONR223 100% 3.4% None (many diffs) n/a
5 ccsbBroad304_10792 pLX_304 0% 3.4% V5 (many diffs) n/a
6 TRCN0000472287 GCCTGGAGAGCTTTCCTCGTCACG pLX_317 100% 3.4% V5 (many diffs) n/a
7 ccsbBroadEn_12783 pDONR223 100% 3% None (many diffs) n/a
8 ccsbBroad304_12783 pLX_304 0% 3% V5 (many diffs) n/a
9 TRCN0000478282 TATCTGCTCCACCGGGCTCCGTTG pLX_317 100% 3% V5 (many diffs) n/a
10 ccsbBroadEn_11616 pDONR223 100% 2.7% None (many diffs) n/a
11 ccsbBroad304_11616 pLX_304 0% 2.7% V5 (many diffs) n/a
12 TRCN0000467678 CCTCCCCTCACACCTCGTCAAAAC pLX_317 100% 2.7% V5 (many diffs) n/a
13 ccsbBroadEn_15487 pDONR223 0% 2.5% None (many diffs) n/a
14 ccsbBroad304_15487 pLX_304 0% 2.5% V5 (many diffs) n/a
15 TRCN0000473708 TAGCATCGTTGCACGCGCACGTTG pLX_317 100% 2.5% V5 (many diffs) n/a
Download CSV