Transcript: Human NM_001098411.3

Homo sapiens G antigen 2B (GAGE2B), mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
GAGE2B (645037)
Length:
509
CDS:
84..434

Additional Resources:

NCBI RefSeq record:
NM_001098411.3
NBCI Gene record:
GAGE2B (645037)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001098411.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243155 CTACGTAGAGCCTCCTGAAAT pLKO_005 128 CDS 100% 13.200 6.600 Y GAGE2E n/a
2 TRCN0000265712 TACGTAGAGCCTCCTGAAATG pLKO_005 129 CDS 100% 10.800 5.400 Y GAGE2D n/a
3 TRCN0000265787 TAGAGCCTCCTGAAATGATTG pLKO_005 133 CDS 100% 10.800 5.400 Y GAGE2A n/a
4 TRCN0000197332 CCTGAAATGATTGGGCCTATG pLKO.1 141 CDS 100% 6.000 3.000 Y GAGE4 n/a
5 TRCN0000262814 ACGTAGAGCCTCCTGAAATGA pLKO_005 130 CDS 100% 5.625 2.813 Y GAGE2B n/a
6 TRCN0000138296 CGTAGAGCCTCCTGAAATGAT pLKO.1 131 CDS 100% 5.625 2.813 Y GAGE1 n/a
7 TRCN0000263271 GTAGAGCCTCCTGAAATGATT pLKO_005 132 CDS 100% 5.625 2.813 Y GAGE13 n/a
8 TRCN0000256038 ACTGGGTGTGAGTGTGAAGAT pLKO_005 330 CDS 100% 4.950 2.475 Y GAGE2D n/a
9 TRCN0000244667 CAGACTGGGTGTGAGTGTGAA pLKO_005 327 CDS 100% 4.950 2.475 Y GAGE4 n/a
10 TRCN0000137608 CCAAATCCAGAGGAGGTGAAA pLKO.1 378 CDS 100% 4.950 2.475 Y GAGE1 n/a
11 TRCN0000155993 CCAAATCCAGAGGAGGTGAAA pLKO.1 378 CDS 100% 4.950 2.475 Y GAGE2C n/a
12 TRCN0000115784 CCCGAGCAGTTCAGTGATGAA pLKO.1 165 CDS 100% 4.950 2.475 Y GAGE7 n/a
13 TRCN0000369735 CCGAGCAGTTCAGTGATGAAG pLKO_005 166 CDS 100% 4.950 2.475 Y GAGE4 n/a
14 TRCN0000138397 CGAGCAGTTCAGTGATGAAGT pLKO.1 167 CDS 100% 4.950 2.475 Y GAGE1 n/a
15 TRCN0000256139 CTGGGTGTGAGTGTGAAGATG pLKO_005 331 CDS 100% 4.950 2.475 Y GAGE12H n/a
16 TRCN0000137684 GAACCAGCAACACCTGAAGAA pLKO.1 189 CDS 100% 4.950 2.475 Y GAGE1 n/a
17 TRCN0000155031 GAACCAGCAACACCTGAAGAA pLKO.1 189 CDS 100% 4.950 2.475 Y GAGE2C n/a
18 TRCN0000419595 GCTACGTAGAGCCTCCTGAAA pLKO_005 127 CDS 100% 4.950 2.475 Y GAGE2C n/a
19 TRCN0000369730 GGAACCAGCAACACCTGAAGA pLKO_005 188 CDS 100% 4.950 2.475 Y GAGE4 n/a
20 TRCN0000371197 ACCAGCAACACCTGAAGAAGG pLKO_005 191 CDS 100% 4.050 2.025 Y GAGE2D n/a
21 TRCN0000263270 AGACCAAGACGCTACGTAGAG pLKO_005 117 CDS 100% 4.050 2.025 Y GAGE13 n/a
22 TRCN0000255889 AGACTGGGTGTGAGTGTGAAG pLKO_005 328 CDS 100% 4.050 2.025 Y GAGE12E n/a
23 TRCN0000243152 AGTGTGAAGATGGTCCTGATG pLKO_005 340 CDS 100% 4.050 2.025 Y GAGE2E n/a
24 TRCN0000256037 AGTTCAGTGATGAAGTGGAAC pLKO_005 172 CDS 100% 4.050 2.025 Y GAGE2D n/a
25 TRCN0000370840 ATGAAGTGGAACCAGCAACAC pLKO_005 181 CDS 100% 4.050 2.025 Y GAGE6 n/a
26 TRCN0000255388 CAGCAACTCAACGTCAGGATC pLKO_005 217 CDS 100% 4.050 2.025 Y GAGE10 n/a
27 TRCN0000243153 CTAGACCAAGACGCTACGTAG pLKO_005 115 CDS 100% 4.050 2.025 Y GAGE2E n/a
28 TRCN0000243156 CTGAAATGATTGGGCCTATGC pLKO_005 142 CDS 100% 4.050 2.025 Y GAGE2E n/a
29 TRCN0000256337 CTGAAGCTCATAGCCAGGAAC pLKO_005 295 CDS 100% 4.050 2.025 Y GAGE2A n/a
30 TRCN0000256138 GAAGCTCATAGCCAGGAACAG pLKO_005 297 CDS 100% 4.050 2.025 Y GAGE12H n/a
31 TRCN0000265695 GAGCAGTTCAGTGATGAAGTG pLKO_005 168 CDS 100% 4.050 2.025 Y GAGE12F n/a
32 TRCN0000115783 GAGTGTGAAGATGGTCCTGAT pLKO.1 339 CDS 100% 4.050 2.025 Y GAGE7 n/a
33 TRCN0000137973 GAGTGTGAAGATGGTCCTGAT pLKO.1 339 CDS 100% 4.050 2.025 Y GAGE1 n/a
34 TRCN0000155220 GATGAAGTGGAACCAGCAACA pLKO.1 180 CDS 100% 4.050 2.025 Y GAGE2C n/a
35 TRCN0000162881 GATGAAGTGGAACCAGCAACA pLKO.1 180 CDS 100% 4.050 2.025 Y GAGE12I n/a
36 TRCN0000243315 GCCAAATCCAGAGGAGGTGAA pLKO_005 377 CDS 100% 4.050 2.025 Y GAGE12I n/a
37 TRCN0000255386 GTGGAACCAGCAACACCTGAA pLKO_005 186 CDS 100% 4.050 2.025 Y GAGE10 n/a
38 TRCN0000265779 GTGTGAAGATGGTCCTGATGG pLKO_005 341 CDS 100% 4.050 2.025 Y GAGE2A n/a
39 TRCN0000282435 TAGACCAAGACGCTACGTAGA pLKO_005 116 CDS 100% 4.050 2.025 Y GAGE2B n/a
40 TRCN0000115782 TCCTGAAATGATTGGGCCTAT pLKO.1 140 CDS 100% 4.050 2.025 Y GAGE7 n/a
41 TRCN0000255890 TGAAGCTCATAGCCAGGAACA pLKO_005 296 CDS 100% 4.050 2.025 Y GAGE12E n/a
42 TRCN0000242734 TGATGAAGTGGAACCAGCAAC pLKO_005 179 CDS 100% 4.050 2.025 Y GAGE5 n/a
43 TRCN0000255718 TGGAACCAGCAACACCTGAAG pLKO_005 187 CDS 100% 4.050 2.025 Y GAGE12F n/a
44 TRCN0000432465 TGGGTGTGAGTGTGAAGATGG pLKO_005 332 CDS 100% 4.050 2.025 Y GAGE2C n/a
45 TRCN0000256336 AGGAGATGGACCCGCCAAATC pLKO_005 364 CDS 100% 3.600 1.800 Y GAGE2A n/a
46 TRCN0000243317 CAGGAGATGGACCCGCCAAAT pLKO_005 363 CDS 100% 3.600 1.800 Y GAGE12I n/a
47 TRCN0000243316 GCCGAAGCCTGAAGCTCATAG pLKO_005 287 CDS 100% 3.600 1.800 Y GAGE12I n/a
48 TRCN0000371199 CCTAGACCAAGACGCTACGTA pLKO_005 114 CDS 100% 3.000 1.500 Y GAGE2D n/a
49 TRCN0000262813 ACAGACTGGGTGTGAGTGTGA pLKO_005 326 CDS 100% 2.640 1.320 Y GAGE2B n/a
50 TRCN0000244666 ACCAGCAACTCAACGTCAGGA pLKO_005 215 CDS 100% 2.640 1.320 Y GAGE4 n/a
51 TRCN0000265767 AGCAGTTCAGTGATGAAGTGG pLKO_005 169 CDS 100% 2.640 1.320 Y GAGE12H n/a
52 TRCN0000265850 AGTGGAACCAGCAACACCTGA pLKO_005 185 CDS 100% 2.640 1.320 Y GAGE12E n/a
53 TRCN0000282344 CAACTCAACGTCAGGATCCTG pLKO_005 220 CDS 100% 2.640 1.320 Y GAGE12G n/a
54 TRCN0000121911 CAGTTCAGTGATGAAGTGGAA pLKO.1 171 CDS 100% 2.640 1.320 Y GAGE7 n/a
55 TRCN0000136873 CAGTTCAGTGATGAAGTGGAA pLKO.1 171 CDS 100% 2.640 1.320 Y GAGE1 n/a
56 TRCN0000115786 CCAGCAACTCAACGTCAGGAT pLKO.1 216 CDS 100% 2.640 1.320 Y GAGE7 n/a
57 TRCN0000415015 CCTGAAGCTCATAGCCAGGAA pLKO_005 294 CDS 100% 2.640 1.320 Y GAGE2C n/a
58 TRCN0000262618 GAAGTGGAACCAGCAACACCT pLKO_005 183 CDS 100% 2.640 1.320 Y GAGE12G n/a
59 TRCN0000281478 GCAACTCAACGTCAGGATCCT pLKO_005 219 CDS 100% 2.640 1.320 Y GAGE2D n/a
60 TRCN0000155329 GCAGTTCAGTGATGAAGTGGA pLKO.1 170 CDS 100% 2.640 1.320 Y GAGE2C n/a
61 TRCN0000250096 GGAACCAGCAACTCAACGTCA pLKO_005 212 CDS 100% 2.640 1.320 Y GAGE6 n/a
62 TRCN0000163548 GTGATGAAGTGGAACCAGCAA pLKO.1 178 CDS 100% 2.640 1.320 Y GAGE12I n/a
63 TRCN0000262201 TGAAATGATTGGGCCTATGCG pLKO_005 143 CDS 100% 2.640 1.320 Y GAGE12D n/a
64 TRCN0000265783 TGAAGTGGAACCAGCAACACC pLKO_005 182 CDS 100% 2.640 1.320 Y GAGE2A n/a
65 TRCN0000262812 TGAGTGTGAAGATGGTCCTGA pLKO_005 338 CDS 100% 2.640 1.320 Y GAGE2B n/a
66 TRCN0000262815 AGCAACTCAACGTCAGGATCC pLKO_005 218 CDS 100% 2.250 1.125 Y GAGE2B n/a
67 TRCN0000255717 GAACCAGCAACTCAACGTCAG pLKO_005 213 CDS 100% 2.250 1.125 Y GAGE12F n/a
68 TRCN0000262875 ACTCAACGTCAGGATCCTGCA pLKO_005 222 CDS 100% 2.160 1.080 Y GAGE12J n/a
69 TRCN0000243319 AGTGATGAAGTGGAACCAGCA pLKO_005 177 CDS 100% 2.160 1.080 Y GAGE12I n/a
70 TRCN0000282455 CAGTGATGAAGTGGAACCAGC pLKO_005 176 CDS 100% 2.160 1.080 Y GAGE12J n/a
71 TRCN0000138463 CTCCTGAAATGATTGGGCCTA pLKO.1 139 CDS 100% 2.160 1.080 Y GAGE1 n/a
72 TRCN0000262199 GTGAGTGTGAAGATGGTCCTG pLKO_005 337 CDS 100% 2.160 1.080 Y GAGE12D n/a
73 TRCN0000281576 TGTGAAGATGGTCCTGATGGG pLKO_005 342 CDS 100% 2.160 1.080 Y GAGE12C n/a
74 TRCN0000370885 GCCCGAGCAGTTCAGTGATGA pLKO_005 164 CDS 100% 1.650 0.825 Y GAGE6 n/a
75 TRCN0000263103 GGCCGAAGCCTGAAGCTCATA pLKO_005 286 CDS 100% 1.650 0.825 Y GAGE12C n/a
76 TRCN0000243318 GGAGAGGATGAGGGAGCATCT pLKO_005 255 CDS 100% 1.350 0.675 Y GAGE12I n/a
77 TRCN0000412836 GAGATGGACCCGCCAAATCCA pLKO_005 366 CDS 100% 1.000 0.500 Y GAGE2C n/a
78 TRCN0000412500 AGAGGATGAGGGAGCATCTGC pLKO_005 257 CDS 100% 0.880 0.440 Y GAGE2C n/a
79 TRCN0000371145 AGGAACAGGGTCACCCACAGA pLKO_005 310 CDS 100% 0.880 0.440 Y GAGE2D n/a
80 TRCN0000371202 GCCTAGACCAAGACGCTACGT pLKO_005 113 CDS 100% 0.880 0.440 Y GAGE2A n/a
81 TRCN0000371148 GGGAACCAGCAACTCAACGTC pLKO_005 211 CDS 100% 0.880 0.440 Y GAGE2A n/a
82 TRCN0000432757 AGGATGAGGGAGCATCTGCAG pLKO_005 259 CDS 100% 0.720 0.360 Y GAGE7 n/a
83 TRCN0000371198 ATCTGCAGGTCAAGGGCCGAA pLKO_005 272 CDS 100% 0.720 0.360 Y GAGE2D n/a
84 TRCN0000415680 CAACGTCAGGATCCTGCAGCT pLKO_005 225 CDS 100% 0.720 0.360 Y GAGE2C n/a
85 TRCN0000371149 CTCAACGTCAGGATCCTGCAG pLKO_005 223 CDS 100% 0.720 0.360 Y GAGE2A n/a
86 TRCN0000426753 CTCATAGCCAGGAACAGGGTC pLKO_005 301 CDS 100% 0.720 0.360 Y GAGE7 n/a
87 TRCN0000370886 TCAACGTCAGGATCCTGCAGC pLKO_005 224 CDS 100% 0.720 0.360 Y GAGE6 n/a
88 TRCN0000369765 GAAATGATTGGGCCTATGCGG pLKO_005 144 CDS 100% 0.660 0.330 Y GAGE4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001098411.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02972 pDONR223 100% 99.7% 99.1% None 220C>G n/a
2 ccsbBroad304_02972 pLX_304 0% 99.7% 99.1% V5 (not translated due to frame shift) 220C>G n/a
3 TRCN0000467585 CGTTGCGCGATTGGCGCAGTTACT pLX_317 88.8% 99.7% 99.1% V5 220C>G n/a
4 ccsbBroadEn_14111 pDONR223 100% 97.7% 93.1% None (many diffs) n/a
5 ccsbBroad304_14111 pLX_304 0% 97.7% 93.1% V5 (not translated due to frame shift) (many diffs) n/a
6 TRCN0000466573 TTGTGTATGCCTCTTGCCACGACC pLX_317 100% 97.7% 93.1% V5 (not translated due to frame shift) (many diffs) n/a
7 ccsbBroadEn_05736 pDONR223 100% 97.7% 96.5% None (many diffs) n/a
8 ccsbBroad304_05736 pLX_304 0% 97.7% 96.5% V5 (many diffs) n/a
9 TRCN0000467570 TATCCGGGAATCACCCTTACCCAG pLX_317 94.9% 97.7% 96.5% V5 (many diffs) n/a
10 ccsbBroadEn_00610 pDONR223 100% 97.4% 95.7% None (many diffs) n/a
11 ccsbBroad304_00610 pLX_304 0% 97.4% 95.7% V5 (not translated due to frame shift) (many diffs) n/a
12 TRCN0000471710 CGGCTTATCACCGACTTTCCCGAT pLX_317 88.1% 97.4% 95.7% V5 (not translated due to prior stop codon) (many diffs) n/a
13 ccsbBroadEn_06249 pDONR223 100% 96.8% 94.8% None (many diffs) n/a
14 ccsbBroad304_06249 pLX_304 0% 96.8% 94.8% V5 (many diffs) n/a
15 TRCN0000478101 CATCGACAATAGGTAGTCAAACGT pLX_317 40.9% 96.8% 94.8% V5 (many diffs) n/a
16 ccsbBroadEn_00603 pDONR223 100% 79.9% 77.1% None (many diffs) n/a
17 ccsbBroad304_00603 pLX_304 0% 79.9% 77.1% V5 (many diffs) n/a
18 TRCN0000466263 GTCGTATTTAGCCCTAATACTCGG pLX_317 96.3% 79.9% 77.1% V5 (many diffs) n/a
Download CSV

GPP Web Portal Terms of Service

Effective Date: December 8, 2025
By using this site, you agree to our terms and conditions below.

Overview of Terms

The data made available on this website were generated for research purposes and are not intended for clinical or commercial uses. Commercial use (or other use for profit-making purposes) of the GPP Web Portal and its tools, is not permitted under these terms and may require a separate license agreement from Broad or its contributors. For more information, please contact partnering@broadinstitute.org.

The original data may be subject to rights claimed by third parties, including but not limited to, patent, copyright, other intellectual property rights, biodiversity-related access and benefit-sharing rights. It is the responsibility of users of Broad Institute services to ensure that their use of the data does not infringe any of the rights of such third parties.

Any questions or comments concerning these Terms of Use can be addressed to: legal@broadinstitute.org.

By accessing and viewing this GPP Web Portal, you agree to the following terms and conditions:

Attribution

You agree to acknowledge the Broad Institute (e.g., in publications, services or products) for any of your use of its online services, databases or software in accordance with good scientific practice. You agree to use the acknowledgment wording provided for the relevant tools as indicated on the FAQ for each tool.

Updating the Terms of Use

We reserve the right to update these Terms of Use at any time. When alterations are inevitable, we will attempt to give reasonable notice of any changes by placing a notice on our website, but you may wish to check each time you use the website. The date of the most recent revision will appear on this, the "GPP Web Portal Terms of Use" page. If you do not agree to these changes, please do not continue to use our online services. We will also make available an archived copy of the previous Terms of Use for comparison.

Indemnification and Disclaimer of Warranties

You are using this GPP Web Portal at your own risk, and you hereby agree to hold Broad and its contributors and their trustees, directors, officers, employees, and affiliated investigators harmless for any third party claims which may arise from your use of the GPP Web Portal, the tools available therein, or any portion thereof. Further, you agree to indemnify Broad, its contributors, and its and their trustees, directors, officers, employees, affiliated investigators, students, and affiliates for any loss, costs, claims, damages, or other liabilities arising from any unpermitted commercial or profit-making use you make of the GPP Web Portal. The GPP Web Portal is a research tool and is provided "as is". Broad does not represent that the GPP Web Portal is free of errors or bugs or suitable for any particular tasks.

ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS ARE DISCLAIMED. IN NO EVENT SHALL BROAD OR ITS CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THE GPP WEB PORTAL, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE.

Governing Law

The terms and conditions herein shall be construed, governed, interpreted, and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A. Furthermore, by accessing, downloading, or using the Database, You consent to the personal jurisdiction of, and venue in, the state and federal courts within Massachusetts with respect to Your download or use of the Database.