Transcript: Human NM_001304284.2

Homo sapiens ubiquitin specific peptidase 6 (USP6), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
USP6 (9098)
Length:
8870
CDS:
2637..6857

Additional Resources:

NCBI RefSeq record:
NM_001304284.2
NBCI Gene record:
USP6 (9098)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001304284.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007337 GCGGAAGGACATACTTATGAA pLKO.1 2678 CDS 100% 5.625 7.875 N USP6 n/a
2 TRCN0000230365 GGAGCGGAAGGACATACTTAT pLKO_005 2675 CDS 100% 13.200 9.240 N USP6 n/a
3 TRCN0000230367 TCATGCCCAGGATCGTGATAA pLKO_005 5450 CDS 100% 13.200 9.240 N USP6 n/a
4 TRCN0000011088 TGCGGAACCAATTCTTCGATA pLKO.1 3604 CDS 100% 4.950 3.465 N USP6 n/a
5 TRCN0000007336 CGTTGGAATCAACAGCAGCAT pLKO.1 2750 CDS 100% 2.640 1.848 N USP6 n/a
6 TRCN0000218643 GCTTCTAGTCCAACACAAATA pLKO_005 5046 CDS 100% 13.200 7.920 N USP6 n/a
7 TRCN0000230368 ACCTGGACATGTCCCATTAAA pLKO_005 8493 3UTR 100% 15.000 7.500 Y USP6 n/a
8 TRCN0000230366 GGGAGAATGGGAGACATATAA pLKO_005 2879 CDS 100% 15.000 7.500 Y USP6 n/a
9 TRCN0000011161 CCAAAGAGAAGACACTCATAT pLKO.1 6539 CDS 100% 13.200 6.600 Y USP32P2 n/a
10 TRCN0000011157 CCCAGACATTAGGAGTTCATA pLKO.1 7892 3UTR 100% 5.625 2.813 Y USP32P2 n/a
11 TRCN0000011159 GCACAATTTCTGCCAAAGATT pLKO.1 6756 CDS 100% 5.625 2.813 Y USP32P2 n/a
12 TRCN0000007335 CCCTGCAAGTTGATTCTCATT pLKO.1 8198 3UTR 100% 4.950 2.475 Y USP6 n/a
13 TRCN0000011160 CCTTCCTGATTATTCACCTTA pLKO.1 5857 CDS 100% 4.950 2.475 Y USP32P2 n/a
14 TRCN0000011087 CCTCCTGAACATTCAGGAAAT pLKO.1 2972 CDS 100% 1.080 0.540 Y USP6 n/a
15 TRCN0000262629 GGTCAGTCCTCCTGAACATTG pLKO_005 2965 CDS 100% 10.800 5.400 Y TBC1D3H n/a
16 TRCN0000118541 CAAGCATCTTAGGGCCTCTAT pLKO.1 3653 CDS 100% 4.950 2.475 Y TBC1D3B n/a
17 TRCN0000148469 CTGGGTTCAAGCAATTCTCTT pLKO.1 2092 5UTR 100% 4.950 2.475 Y C16orf89 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001304284.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492225 TATACGCCTCCTCACCATAAATTC pLX_317 8% 69.1% 58.4% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000488115 GTCATCACGCGGCCGTTATCCCAT pLX_317 7.3% 69.1% 58.3% V5 (many diffs) n/a
3 ccsbBroadEn_10145 pDONR223 100% 33.9% 29.9% None (many diffs) n/a
4 ccsbBroad304_10145 pLX_304 0% 33.9% 29.9% V5 (many diffs) n/a
5 ccsbBroadEn_13692 pDONR223 100% 21.4% 18.6% None (many diffs) n/a
6 ccsbBroad304_13692 pLX_304 0% 21.4% 18.6% V5 (many diffs) n/a
7 TRCN0000471618 GCCCATAACCCTACGTGGCCAATT pLX_317 40.7% 21.4% 18.6% V5 (many diffs) n/a
8 ccsbBroadEn_12794 pDONR223 100% 18% 14.6% None (many diffs) n/a
9 ccsbBroad304_12794 pLX_304 0% 18% 14.6% V5 (many diffs) n/a
10 ccsbBroadEn_11333 pDONR223 100% 11.1% 11% None 1_6delATGGAC;155_156ins183;496_4218del n/a
11 ccsbBroad304_11333 pLX_304 0% 11.1% 11% V5 1_6delATGGAC;155_156ins183;496_4218del n/a
12 TRCN0000471012 TAGTACGAGTCAGATGCACTGGCC pLX_317 54.4% 11.1% 11% V5 1_6delATGGAC;155_156ins183;496_4218del n/a
13 ccsbBroadEn_13327 pDONR223 100% 4.9% 4.3% None (many diffs) n/a
14 ccsbBroad304_13327 pLX_304 0% 4.9% 4.3% V5 (many diffs) n/a
15 TRCN0000476448 GTATAATACAGCTCGGATCTAGCC pLX_317 100% 4.9% 4.3% V5 (many diffs) n/a
Download CSV