Transcript: Human NM_005947.3

Homo sapiens metallothionein 1B (MT1B), mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
MT1B (4490)
Length:
393
CDS:
69..254

Additional Resources:

NCBI RefSeq record:
NM_005947.3
NBCI Gene record:
MT1B (4490)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005947.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000183971 CTGCAAAGGCTCATCAGAGAA pLKO.1 215 CDS 100% 4.950 3.465 N MT1B n/a
2 TRCN0000184367 GCAAAGGCTCATCAGAGAAGT pLKO.1 217 CDS 100% 4.950 3.465 N MT1B n/a
3 TRCN0000152995 GTGCAAAGAGTGCAAATGTAC pLKO.1 128 CDS 100% 4.950 2.970 N MT1B n/a
4 TRCN0000156510 GCAAATGTACCTCCTGCAAGA pLKO.1 139 CDS 100% 4.050 2.430 N MT1B n/a
5 TRCN0000219902 GCAAGAAGTGCTGCTGCTCTT pLKO.1 154 CDS 100% 4.050 2.430 N MT1B n/a
6 TRCN0000179258 GCAAAGAGTGCAAATGTACCT pLKO.1 130 CDS 100% 2.640 1.584 N MT1B n/a
7 TRCN0000156762 GTGCAAATGTACCTCCTGCAA pLKO.1 137 CDS 100% 2.640 1.584 N MT1B n/a
8 TRCN0000219903 GCTGTGCCTGATGTTGGGAGA pLKO.1 244 CDS 100% 0.720 0.432 N MT1B n/a
9 TRCN0000242867 CAAGTGCAAAGAGTGCAAATG pLKO_005 125 CDS 100% 10.800 5.400 Y MT1G n/a
10 TRCN0000072609 GCAAGTGCAAAGAGTGCAAAT pLKO.1 124 CDS 100% 10.800 5.400 Y MT1F n/a
11 TRCN0000153590 GCAAGTGCAAAGAGTGCAAAT pLKO.1 124 CDS 100% 10.800 5.400 Y MT1E n/a
12 TRCN0000156365 CTGCAAGTGCAAAGAGTGCAA pLKO.1 122 CDS 100% 2.640 1.320 Y MT1E n/a
13 TRCN0000219901 CGGCTCCTGCAAGTGCAAAGA pLKO.1 116 CDS 100% 1.650 0.825 Y MT1B n/a
14 TRCN0000257215 GCCGGCTCCTGCAAGTGCAAA pLKO_005 114 CDS 100% 0.000 0.000 Y MT1H n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005947.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01039 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01039 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468729 CAAAATATTAAAACTGATCGTATT pLX_317 100% 100% 100% V5 n/a
4 ccsbBroadEn_01042 pDONR223 100% 91.2% 86.8% None (many diffs) n/a
5 ccsbBroad304_01042 pLX_304 0% 91.2% 86.8% V5 (many diffs) n/a
6 TRCN0000470527 TTTTTAACCATTGCTGGCACAAAG pLX_317 100% 91.2% 86.8% V5 (many diffs) n/a
7 ccsbBroadEn_01040 pDONR223 100% 91.2% 91.8% None (many diffs) n/a
8 ccsbBroad304_01040 pLX_304 0% 91.2% 91.8% V5 (many diffs) n/a
9 TRCN0000465872 GTAGAGTCACTGCCTTGTCCTAGG pLX_317 100% 91.2% 91.8% V5 (many diffs) n/a
10 ccsbBroadEn_06598 pDONR223 100% 89.6% 83.6% None (many diffs) n/a
11 ccsbBroad304_06598 pLX_304 0% 89.6% 83.6% V5 (many diffs) n/a
12 TRCN0000473594 TGCAAGCTAGAGCAGCCGCGTATG pLX_317 100% 89.6% 83.6% V5 (many diffs) n/a
13 ccsbBroadEn_01044 pDONR223 100% 89.6% 86.8% None (many diffs) n/a
14 ccsbBroad304_01044 pLX_304 0% 89.6% 86.8% V5 (many diffs) n/a
15 TRCN0000475214 ATCGACCACCTTCTCGGATCAACG pLX_317 100% 89.6% 86.8% V5 (many diffs) n/a
16 ccsbBroadEn_01043 pDONR223 100% 89.6% 86.8% None (many diffs) n/a
17 ccsbBroad304_01043 pLX_304 0% 89.6% 86.8% V5 (many diffs) n/a
18 ccsbBroadEn_06599 pDONR223 100% 89% 86.8% None (many diffs) n/a
19 ccsbBroad304_06599 pLX_304 0% 89% 86.8% V5 (many diffs) n/a
20 TRCN0000474764 TTGATAACTTTGGCATCACCATAC pLX_317 100% 89% 86.8% V5 (many diffs) n/a
21 ccsbBroadEn_01045 pDONR223 100% 88.5% 85.2% None (many diffs) n/a
22 ccsbBroad304_01045 pLX_304 0% 88.5% 85.2% V5 (many diffs) n/a
23 TRCN0000472152 TGCCGATATAGCTCTCTATACTCA pLX_317 100% 88.5% 85.2% V5 (many diffs) n/a
24 ccsbBroadEn_01041 pDONR223 100% 88.5% 85.2% None (many diffs) n/a
25 ccsbBroad304_01041 pLX_304 95.5% 88.5% 85.2% V5 (many diffs) n/a
26 ccsbBroadEn_13207 pDONR223 100% 87.9% 85.2% None (many diffs) n/a
27 ccsbBroad304_13207 pLX_304 0% 87.9% 85.2% V5 (many diffs) n/a
28 TRCN0000467056 AGATTTTCATGCAACTTTTCTCGA pLX_317 100% 87.9% 85.2% V5 (many diffs) n/a
29 ccsbBroadEn_10353 pDONR223 100% 70.4% 65.5% None (many diffs) n/a
30 ccsbBroad304_10353 pLX_304 0% 70.4% 65.5% V5 (many diffs) n/a
31 TRCN0000473861 CGCCCGCAGATCATTCGATACGCC pLX_317 100% 70.4% 65.5% V5 (many diffs) n/a
Download CSV