Transcript: Human NM_033468.4

Homo sapiens zinc finger protein 257 (ZNF257), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
ZNF257 (113835)
Length:
3879
CDS:
150..1841

Additional Resources:

NCBI RefSeq record:
NM_033468.4
NBCI Gene record:
ZNF257 (113835)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_033468.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000018037 CTCATACCTTACCGTACATAA pLKO.1 1730 CDS 100% 13.200 9.240 N ZNF257 n/a
2 TRCN0000412731 TTTGCCCAGAGCGAGACATAA pLKO_005 403 CDS 100% 13.200 9.240 N ZNF257 n/a
3 TRCN0000433690 CTCAACATTTACTAAGCATAA pLKO_005 1975 3UTR 100% 10.800 7.560 N ZNF257 n/a
4 TRCN0000414562 GCCCTTCAAATATGATGAATG pLKO_005 998 CDS 100% 10.800 7.560 N ZNF257 n/a
5 TRCN0000421339 GCGAAACTACAATCCTGAATG pLKO_005 2255 3UTR 100% 10.800 7.560 N ZNF257 n/a
6 TRCN0000018035 CGGTCTTCACACATTACTCAA pLKO.1 951 CDS 100% 4.950 3.465 N ZNF257 n/a
7 TRCN0000018033 CCTCAGCTCTTACTACCCTTA pLKO.1 1039 CDS 100% 4.050 2.835 N ZNF257 n/a
8 TRCN0000416136 AGTGCGAAACTCTAGAAATAT pLKO_005 2335 3UTR 100% 15.000 9.000 N ZNF257 n/a
9 TRCN0000018036 CCCAGTTATGTGTTCTCATAT pLKO.1 371 CDS 100% 13.200 6.600 Y ZNF257 n/a
10 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 820 CDS 100% 13.200 6.600 Y Zfp934 n/a
11 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 820 CDS 100% 13.200 6.600 Y 2810408B13Rik n/a
12 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 820 CDS 100% 13.200 6.600 Y EG668616 n/a
13 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 3673 3UTR 100% 4.950 2.475 Y ORAI2 n/a
14 TRCN0000016587 CCTGGGTATTGCTGTCTCTAA pLKO.1 275 CDS 100% 4.950 2.475 Y ZNF675 n/a
15 TRCN0000074123 CGCCTGTAATCCCAACACTTT pLKO.1 3595 3UTR 100% 4.950 2.475 Y GJD4 n/a
16 TRCN0000166650 CGCCTGTAATCCCAACACTTT pLKO.1 3595 3UTR 100% 4.950 2.475 Y C9orf85 n/a
17 TRCN0000018502 GATGTTAGAGAACTACAGAAA pLKO.1 245 CDS 100% 4.950 2.475 Y ZNF493 n/a
18 TRCN0000149073 GCAAAGCCTTTAACCAGTCTT pLKO.1 1543 CDS 100% 4.950 2.475 Y ZNF714 n/a
19 TRCN0000107758 TGTCTCTAAGCCAGACCTGAT pLKO.1 287 CDS 100% 4.050 2.025 Y ZNF273 n/a
20 TRCN0000147126 CCCAGTTATGTGTTCTCATTT pLKO.1 371 CDS 100% 13.200 6.600 Y ZNF43 n/a
21 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 3670 3UTR 100% 4.950 2.475 Y LOC339059 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033468.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13028 pDONR223 100% 94.1% 94.1% None 1_96del;802C>A;1063C>G n/a
2 ccsbBroad304_13028 pLX_304 0% 94.1% 94.1% V5 1_96del;802C>A;1063C>G n/a
3 TRCN0000468257 GTACACCAGACCACTACATGCGAC pLX_317 25.6% 94.1% 94.1% V5 1_96del;802C>A;1063C>G n/a
4 ccsbBroadEn_15278 pDONR223 59.5% 80.5% 69% None (many diffs) n/a
5 ccsbBroad304_15278 pLX_304 0% 80.5% 69% V5 (many diffs) n/a
6 ccsbBroadEn_15167 pDONR223 53.6% 77.2% 32.4% None (many diffs) n/a
7 ccsbBroad304_15167 pLX_304 0% 77.2% 32.4% V5 (not translated due to prior stop codon) (many diffs) n/a
8 ccsbBroadEn_02188 pDONR223 100% 72.1% 62.8% None (many diffs) n/a
9 ccsbBroad304_02188 pLX_304 0% 72.1% 62.8% V5 (many diffs) n/a
10 TRCN0000476436 TCCGTGTTGGTCAAGCGACGCGCC pLX_317 12.5% 72.1% 62.8% V5 (many diffs) n/a
11 ccsbBroadEn_07157 pDONR223 100% 58.4% 49.2% None (many diffs) n/a
12 ccsbBroad304_07157 pLX_304 0% 58.4% 49.2% V5 (many diffs) n/a
13 TRCN0000475452 TAAAACTTCAACTTGGTTTCCTTC pLX_317 10.2% 58.4% 49.2% V5 (many diffs) n/a
14 ccsbBroadEn_15729 pDONR223 0% 13.3% 12% None (many diffs) n/a
15 ccsbBroad304_15729 pLX_304 0% 13.3% 12% V5 (many diffs) n/a
16 TRCN0000470492 GCCGACTTGCTCCATGATGCAGCT pLX_317 100% 13.3% 12% V5 (many diffs) n/a
17 ccsbBroadEn_11384 pDONR223 100% 12.6% 11% None (many diffs) n/a
18 ccsbBroad304_11384 pLX_304 0% 12.6% 11% V5 (many diffs) n/a
19 TRCN0000470576 TACATACAGACCTACACGTAGACC pLX_317 100% 12.6% 11% V5 (many diffs) n/a
20 ccsbBroadEn_13746 pDONR223 100% 12.1% 10.6% None (many diffs) n/a
21 ccsbBroad304_13746 pLX_304 0% 12.1% 10.6% V5 (many diffs) n/a
22 TRCN0000475669 ATTCGCAGCGAGTTTGTCCGCCGC pLX_317 100% 12.1% 10.6% V5 (many diffs) n/a
23 ccsbBroadEn_11549 pDONR223 100% 8.2% 7.6% None (many diffs) n/a
24 ccsbBroad304_11549 pLX_304 94.6% 8.2% 7.6% V5 (many diffs) n/a
25 TRCN0000468281 AACATTAGGAAAGAACCCCCACCC pLX_317 100% 8.2% 7.6% V5 (many diffs) n/a
26 ccsbBroad304_10227 pLX_304 0% 8.1% 6.9% V5 (many diffs) n/a
27 TRCN0000469516 ACTCCATTCTCACCCTCTGCATTC pLX_317 100% 8.1% 6.9% V5 (many diffs) n/a
Download CSV