Transcript: Human NR_027392.2

Homo sapiens integrator complex subunit 4 pseudogene 2 (INTS4P2), non-coding RNA.

Source:
NCBI, updated 2018-05-24
Taxon:
Homo sapiens (human)
Gene:
INTS4P2 (644619)
Length:
1768
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_027392.2
NBCI Gene record:
INTS4P2 (644619)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_027392.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000134641 GTCCCAATTCCTTCTTCTAAT pLKO.1 199 3UTR 100% 13.200 6.600 Y INTS4P1 n/a
2 TRCN0000017460 GAGATGTATGAGGTTCGTATT pLKO.1 553 3UTR 100% 10.800 5.400 Y LOC402530 n/a
3 TRCN0000134429 GAGATGTATGAGGTTCGTATT pLKO.1 553 3UTR 100% 10.800 5.400 Y INTS4P1 n/a
4 TRCN0000016523 GCAAGTCAGTTCTCATTTCTT pLKO.1 327 3UTR 100% 5.625 2.813 Y LOC401361 n/a
5 TRCN0000129887 GCAAGTCAGTTCTCATTTCTT pLKO.1 327 3UTR 100% 5.625 2.813 Y INTS4 n/a
6 TRCN0000016526 CCTACTGATAGGGACTCCATA pLKO.1 886 3UTR 100% 4.950 2.475 Y LOC401361 n/a
7 TRCN0000016524 CCTTGAGGTTACCAGGTAGAA pLKO.1 1154 3UTR 100% 4.950 2.475 Y LOC401361 n/a
8 TRCN0000017462 CCTTGATTTCCTAGTTGACAT pLKO.1 633 3UTR 100% 4.950 2.475 Y LOC402530 n/a
9 TRCN0000016527 CGAGACAGTCTTTCTCATCTT pLKO.1 1126 3UTR 100% 4.950 2.475 Y LOC401361 n/a
10 TRCN0000136432 CGAGACAGTCTTTCTCATCTT pLKO.1 1126 3UTR 100% 4.950 2.475 Y INTS4P1 n/a
11 TRCN0000017461 CTGTCCAACAATGCGAGCATT pLKO.1 1068 3UTR 100% 4.950 2.475 Y LOC402530 n/a
12 TRCN0000016525 GCTCCCAAGGAAGAAGTAGAT pLKO.1 469 3UTR 100% 4.950 2.475 Y LOC401361 n/a
13 TRCN0000017459 GCTGAACCAGACATGGATGAT pLKO.1 1000 3UTR 100% 4.950 2.475 Y LOC402530 n/a
14 TRCN0000129371 GCTGAACCAGACATGGATGAT pLKO.1 1000 3UTR 100% 4.950 2.475 Y INTS4 n/a
15 TRCN0000136690 GCTGAACCAGACATGGATGAT pLKO.1 1000 3UTR 100% 4.950 2.475 Y INTS4P1 n/a
16 TRCN0000017458 GTCCATACATACCATGAGAAA pLKO.1 687 3UTR 100% 4.950 2.475 Y LOC402530 n/a
17 TRCN0000134671 GTCCATACATACCATGAGAAA pLKO.1 687 3UTR 100% 4.950 2.475 Y INTS4P1 n/a
18 TRCN0000128108 CGCTTAGTTGATGATGCGTTT pLKO.1 229 3UTR 100% 4.050 2.025 Y INTS4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_027392.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13723 pDONR223 100% 74.4% None 1_27del;1345_1768del n/a
2 ccsbBroad304_13723 pLX_304 0% 74.4% V5 1_27del;1345_1768del n/a
3 TRCN0000469026 TTGCGCAAGTTGCCCGAAACCAAC pLX_317 32.2% 74.4% V5 1_27del;1345_1768del n/a
4 ccsbBroadEn_12975 pDONR223 100% 64.9% None (many diffs) n/a
5 ccsbBroad304_12975 pLX_304 0% 64.9% V5 (many diffs) n/a
6 TRCN0000491572 TCTTGCAAAAGGGGAGCATACACC pLX_317 25% 64.9% V5 (many diffs) n/a
7 ccsbBroadEn_12974 pDONR223 100% 35% None (many diffs) n/a
8 ccsbBroad304_12974 pLX_304 0% 35% V5 (many diffs) n/a
9 TRCN0000470961 GAATTATTCATAGACCCCCAATAG pLX_317 30.1% 35% V5 (many diffs) n/a
Download CSV