Transcript: Human NR_040583.2

Homo sapiens stromal antigen 3-like 1 (pseudogene) (STAG3L1), non-coding RNA.

Source:
NCBI, updated 2018-05-24
Taxon:
Homo sapiens (human)
Gene:
STAG3L1 (54441)
Length:
2138
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_040583.2
NBCI Gene record:
STAG3L1 (54441)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_040583.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121694 CCTCACCGACAGCTATTTAAA pLKO.1 628 3UTR 100% 15.000 7.500 Y STAG3L3 n/a
2 TRCN0000359633 CGCCCAGCATGTTAGACAATT pLKO_005 1601 3UTR 100% 13.200 6.600 Y STAG3L1 n/a
3 TRCN0000062688 GCCCAGCATGTTAGACAATTT pLKO.1 1602 3UTR 100% 13.200 6.600 Y STAG3L1 n/a
4 TRCN0000062692 GCTATCTGCATTGAGGAAATT pLKO.1 575 3UTR 100% 13.200 6.600 Y STAG3L1 n/a
5 TRCN0000139360 CAGCTTCTGCTGTCCTTCTTT pLKO.1 1046 3UTR 100% 5.625 2.813 Y STAG3L3 n/a
6 TRCN0000167398 GAATTTCTGTACTGGAAACTT pLKO.1 947 3UTR 100% 5.625 2.813 Y STAG3L2 n/a
7 TRCN0000062689 GCCGTCAGATTACTGATACTT pLKO.1 827 3UTR 100% 5.625 2.813 Y STAG3L1 n/a
8 TRCN0000135957 GCCGTCAGATTACTGATACTT pLKO.1 827 3UTR 100% 5.625 2.813 Y STAG3 n/a
9 TRCN0000142277 GCCGTCAGATTACTGATACTT pLKO.1 827 3UTR 100% 5.625 2.813 Y STAG3L3 n/a
10 TRCN0000062690 CGCTGCTTACTTAGTAGACAA pLKO.1 1090 3UTR 100% 4.950 2.475 Y STAG3L1 n/a
11 TRCN0000167941 CGCTGCTTACTTAGTAGACAA pLKO.1 1090 3UTR 100% 4.950 2.475 Y STAG3L2 n/a
12 TRCN0000168487 GAGAGATTGCTTGCTTCACTT pLKO.1 1241 3UTR 100% 4.950 2.475 Y STAG3L2 n/a
13 TRCN0000139995 GAGATCCGTGCTATCTGCATT pLKO.1 566 3UTR 100% 4.950 2.475 Y STAG3L3 n/a
14 TRCN0000062691 GCAAAGCTACAGCACGTCTTT pLKO.1 607 3UTR 100% 4.950 2.475 Y STAG3L1 n/a
15 TRCN0000122408 GCAAAGCTACAGCACGTCTTT pLKO.1 607 3UTR 100% 4.950 2.475 Y STAG3L3 n/a
16 TRCN0000138869 GCAAAGCTACAGCACGTCTTT pLKO.1 607 3UTR 100% 4.950 2.475 Y STAG3 n/a
17 TRCN0000172776 GCTTCAAGGACTGGATGGTTT pLKO.1 768 3UTR 100% 4.950 2.475 Y STAG3L2 n/a
18 TRCN0000139256 CTGCATGATAAGCACCGAGAA pLKO.1 665 3UTR 100% 4.050 2.025 Y STAG3L3 n/a
19 TRCN0000140844 CAGAGGACTTTCTTCCAGCTT pLKO.1 1031 3UTR 100% 2.640 1.320 Y STAG3L3 n/a
20 TRCN0000142181 GTTTCCATGATCATGGACAGA pLKO.1 785 3UTR 100% 0.264 0.132 Y STAG3L3 n/a
21 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1567 3UTR 100% 5.625 2.813 Y KLHL30 n/a
22 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1896 3UTR 100% 4.950 2.475 Y KAAG1 n/a
23 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1567 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_040583.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10171 pDONR223 100% 18.8% None 1_508del;911_2138del n/a
2 ccsbBroad304_10171 pLX_304 0% 18.8% V5 1_508del;911_2138del n/a
3 TRCN0000474301 GGCATGATAACGCGACACGTACAC pLX_317 60.6% 18.8% V5 1_508del;911_2138del n/a
4 ccsbBroadEn_13704 pDONR223 100% 11.1% None (many diffs) n/a
5 ccsbBroad304_13704 pLX_304 0% 11.1% V5 (many diffs) n/a
6 ccsbBroadEn_12038 pDONR223 100% 11% None 1_994del;1232_2138del n/a
7 ccsbBroad304_12038 pLX_304 0% 11% V5 1_994del;1232_2138del n/a
8 TRCN0000471778 CAAGTTTGACTAGCTTGAAGTGGC pLX_317 100% 11% V5 1_994del;1232_2138del n/a
Download CSV