Transcript: Human NR_160913.1

Homo sapiens H2B histone pseudogene 2 (H2BP2), transcript variant 1, non-coding RNA.

Source:
NCBI, updated 2019-07-25
Taxon:
Homo sapiens (human)
Gene:
H2BP2 (338391)
Length:
2439
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_160913.1
NBCI Gene record:
H2BP2 (338391)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_160913.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000106872 CAAGGAGAGCTACTCCGTTTA pLKO.1 149 3UTR 100% 10.800 5.400 Y H2BC18 n/a
2 TRCN0000106713 CTCCTTCGTCAACGACATCTT pLKO.1 239 3UTR 100% 4.950 2.475 Y H2BC12 n/a
3 TRCN0000106874 TGTTACGAAAGTGCAGAAGAA pLKO.1 101 3UTR 100% 4.950 2.475 Y H2BC18 n/a
4 TRCN0000431230 ATCATGAACTCCTTCGTCAAC pLKO_005 231 3UTR 100% 4.050 2.025 Y H2BC14 n/a
5 TRCN0000106676 CATCATGAACTCCTTCGTCAA pLKO.1 230 3UTR 100% 4.050 2.025 Y H2BC15 n/a
6 TRCN0000256092 TACAACAAGCGCTCCACCATC pLKO_005 297 3UTR 100% 4.050 2.025 Y H2BC7 n/a
7 TRCN0000431028 TCATGAACTCCTTCGTCAACG pLKO_005 232 3UTR 100% 4.050 2.025 Y H2BC13 n/a
8 TRCN0000106998 CATGGGCATCATGAACTCCTT pLKO.1 224 3UTR 100% 2.640 1.320 Y H2BC7 n/a
9 TRCN0000106963 CAACGACATCTTCGAGCGCAT pLKO.1 248 3UTR 100% 2.160 1.080 Y H2BC13 n/a
10 TRCN0000106871 GCTCCCAAGAAGGGCTCCAAA pLKO.1 75 3UTR 100% 1.650 0.825 Y H2BC18 n/a
11 TRCN0000096960 GAAGCGCAAGCGCAGCCGCAA pLKO.1 131 3UTR 100% 0.000 0.000 Y Hist1h2bn n/a
12 TRCN0000096963 GCGCAGCCGCAAGGAGAGCTA pLKO.1 140 3UTR 100% 0.000 0.000 Y Hist1h2bn n/a
13 TRCN0000106873 CAAGTACACCAGCTCGAAGTA pLKO.1 407 3UTR 100% 4.950 2.475 Y H2BC18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_160913.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05671 pDONR223 100% 15.2% None (many diffs) n/a
2 ccsbBroad304_05671 pLX_304 0% 15.2% V5 (many diffs) n/a
3 TRCN0000476574 TAAAAAAACATGTTATCTATAAGA pLX_317 92.5% 15.2% V5 (many diffs) n/a
4 ccsbBroadEn_01903 pDONR223 100% 14.4% None (many diffs) n/a
5 ccsbBroad304_01903 pLX_304 0% 14.4% V5 (many diffs) n/a
6 TRCN0000474598 ACTACAGCTCACCGGCGTAGGAAC pLX_317 100% 14.4% V5 (many diffs) n/a
7 ccsbBroadEn_07224 pDONR223 100% 14.3% None (many diffs) n/a
8 ccsbBroad304_07224 pLX_304 0% 14.3% V5 (many diffs) n/a
9 TRCN0000472239 ATGAGCATATTTAAATGCTTTCTC pLX_317 100% 14.3% V5 (many diffs) n/a
10 ccsbBroadEn_04472 pDONR223 100% 14.1% None (many diffs) n/a
11 ccsbBroad304_04472 pLX_304 0% 14.1% V5 (many diffs) n/a
12 TRCN0000471184 TCCCCACAGAAAAAGCTTCGCGAC pLX_317 82.9% 14.1% V5 (many diffs) n/a
13 ccsbBroadEn_12031 pDONR223 100% 14% None (many diffs) n/a
14 ccsbBroad304_12031 pLX_304 0% 14% V5 (many diffs) n/a
15 TRCN0000469135 AACATACCTTGTTGTCATTTATTA pLX_317 100% 14% V5 (many diffs) n/a
16 ccsbBroadEn_04839 pDONR223 100% 14% None (many diffs) n/a
17 ccsbBroad304_04839 pLX_304 0% 14% V5 (many diffs) n/a
18 TRCN0000466986 TCACGGGATGAGCTCCAAAAATGA pLX_317 100% 14% V5 (many diffs) n/a
19 ccsbBroadEn_15861 pDONR223 0% 14% None (many diffs) n/a
20 ccsbBroad304_15861 pLX_304 0% 14% V5 (many diffs) n/a
21 TRCN0000466058 TATAACTAACAAACAAGCTAACTT pLX_317 98.5% 14% V5 (many diffs) n/a
22 ccsbBroadEn_01900 pDONR223 100% 13.9% None (many diffs) n/a
23 ccsbBroad304_01900 pLX_304 0% 13.9% V5 (many diffs) n/a
24 TRCN0000470158 AGTTTACTCTTCCCTTTATTAGAT pLX_317 90.5% 13.9% V5 (many diffs) n/a
25 ccsbBroadEn_01898 pDONR223 100% 13.9% None (many diffs) n/a
26 ccsbBroad304_01898 pLX_304 0% 13.9% V5 (many diffs) n/a
27 TRCN0000469156 CCCGCACAGGGATTAGCAAAGTTG pLX_317 89.9% 13.9% V5 (many diffs) n/a
28 ccsbBroadEn_01902 pDONR223 100% 13.7% None (many diffs) n/a
29 ccsbBroad304_01902 pLX_304 0% 13.7% V5 (many diffs) n/a
30 TRCN0000473896 CTGGCTTAAGACAGAATAAACCCC pLX_317 100% 13.7% V5 (many diffs) n/a
31 ccsbBroadEn_06348 pDONR223 100% 13.7% None (many diffs) n/a
32 ccsbBroad304_06348 pLX_304 0% 13.7% V5 (many diffs) n/a
33 TRCN0000466554 GCTTTTTGTCTTCCCTACTCACGT pLX_317 98.5% 13.7% V5 (many diffs) n/a
34 ccsbBroadEn_07223 pDONR223 100% 13.6% None (many diffs) n/a
35 ccsbBroad304_07223 pLX_304 0% 13.6% V5 (many diffs) n/a
36 TRCN0000471318 CGGCGACCCACTCTTCACCGCCCG pLX_317 96.2% 13.6% V5 (many diffs) n/a
37 ccsbBroadEn_01901 pDONR223 100% 13.6% None (many diffs) n/a
38 ccsbBroad304_01901 pLX_304 0% 13.6% V5 (many diffs) n/a
39 TRCN0000468700 CGACGATGACTCTCCCTCATTTGA pLX_317 100% 13.6% V5 (many diffs) n/a
40 ccsbBroadEn_01899 pDONR223 100% 13.4% None (many diffs) n/a
41 ccsbBroad304_01899 pLX_304 0% 13.4% V5 (many diffs) n/a
42 TRCN0000477535 GAGTATGATTCTCGACACACTATA pLX_317 98.5% 13.4% V5 (many diffs) n/a
43 ccsbBroadEn_01897 pDONR223 100% 13.4% None (many diffs) n/a
44 ccsbBroad304_01897 pLX_304 0% 13.4% V5 (many diffs) n/a
45 TRCN0000471861 TGCACGGGACGCACCAAATGACCA pLX_317 90.4% 13.4% V5 (many diffs) n/a
46 ccsbBroadEn_10354 pDONR223 100% 8.3% None (many diffs) n/a
47 ccsbBroad304_10354 pLX_304 0% 8.3% V5 (many diffs) n/a
48 TRCN0000466355 TTCTAACCCCTTTGTAGACCAATG pLX_317 100% 8.3% V5 (many diffs) n/a
Download CSV