Transcript: Mouse NM_007912.4

Mus musculus epidermal growth factor receptor (Egfr), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Egfr (13649)
Length:
2678
CDS:
281..2248

Additional Resources:

NCBI RefSeq record:
NM_007912.4
NBCI Gene record:
Egfr (13649)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007912.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000023479 CCTCTGCAATATGGATACTAT pLKO.1 745 CDS 100% 5.625 7.875 N Egfr n/a
2 TRCN0000055219 GCCAATAATGTCTGCCACCTA pLKO.1 2117 CDS 100% 2.640 2.112 N Egfr n/a
3 TRCN0000023481 CCTGTCCAACTATGGGACAAA pLKO.1 643 CDS 100% 0.495 0.396 N Egfr n/a
4 TRCN0000055222 GCATAGGCATTGGTGAATTTA pLKO.1 1296 CDS 100% 15.000 10.500 N Egfr n/a
5 TRCN0000023483 GCTTTCGAGAACCTAGAAATA pLKO.1 1535 CDS 100% 13.200 9.240 N Egfr n/a
6 TRCN0000348123 GCTTTCGAGAACCTAGAAATA pLKO_005 1535 CDS 100% 13.200 9.240 N Egfr n/a
7 TRCN0000023480 GCAAACACAATAAACTGGAAA pLKO.1 1694 CDS 100% 4.950 3.465 N Egfr n/a
8 TRCN0000348190 GCAAACACAATAAACTGGAAA pLKO_005 1694 CDS 100% 4.950 3.465 N Egfr n/a
9 TRCN0000023482 GCAGTGGATCTTAAAGACCTT pLKO.1 2218 CDS 100% 2.640 1.584 N Egfr n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007912.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491764 CACTCATGTCGTGGCCCAAAAAAT pLX_317 6.2% 45.2% 46.6% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489095 ACACCCGTTACCGGACACTAAACA pLX_317 9.2% 45.1% 46.5% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000488391 ACTAGCAATTCCGCAGTGTATGAG pLX_317 9.2% 45.1% 46.4% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000489511 CTCATTCCAAATATTCTTATAAAG pLX_317 10.6% 45% 48.2% V5 (not translated due to prior stop codon) (many diffs) n/a
5 ccsbBroadEn_14622 pDONR223 0% 44.9% 46.3% None (many diffs) n/a
6 TRCN0000470680 TTTCCTGTACTCAGTCAATTTGTA pLX_317 10.3% 44.9% 46.3% V5 (many diffs) n/a
7 TRCN0000489587 TTCCGACATTAAGCCGCAACCGAG pLX_317 11.6% 44.9% 46.3% V5 (many diffs) n/a
8 TRCN0000487903 TTTGATCTATAGGTAATTAATTAT pLX_317 8.6% 44.9% 46.3% V5 (not translated due to prior stop codon) (many diffs) n/a
9 TRCN0000491390 TACATTGGTATCCTAGTAACCCAG pLX_317 8.6% 44.9% 46.3% V5 (not translated due to prior stop codon) (many diffs) n/a
10 TRCN0000489590 AGGCTGCTTTATAAGACAGAGCAC pLX_317 11.8% 44.9% 46.3% V5 (not translated due to prior stop codon) (many diffs) n/a
11 TRCN0000489889 TCAAGTATCAGACCACTAAACATC pLX_317 11.3% 44.9% 46.3% V5 (not translated due to prior stop codon) (many diffs) n/a
12 ccsbBroadEn_13848 pDONR223 100% 44.8% 46.3% None (many diffs) n/a
13 ccsbBroad304_13848 pLX_304 0% 44.8% 46.3% V5 (many diffs) n/a
14 TRCN0000475806 AGCGTCACAGGCTAACATACTCCG pLX_317 9.6% 44.8% 46.3% V5 (many diffs) n/a
Download CSV