Transcript: Human NM_001363990.1

Homo sapiens calcium/calmodulin dependent protein kinase II alpha (CAMK2A), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
CAMK2A (815)
Length:
4990
CDS:
335..1771

Additional Resources:

NCBI RefSeq record:
NM_001363990.1
NBCI Gene record:
CAMK2A (815)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001363990.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000010284 GTGCGGAAACAGGAAATTATA pLKO.1 1367 CDS 100% 15.000 21.000 N CAMK2A n/a
2 TRCN0000010283 AGAGCGATGGTGTGAAGGAAT pLKO.1 1302 CDS 100% 4.950 6.930 N CAMK2A n/a
3 TRCN0000010285 GGGACACCACTACCTGATCTT pLKO.1 580 CDS 100% 4.950 6.930 N CAMK2A n/a
4 TRCN0000194797 CATGACTTTATACGCAGTAAG pLKO.1 3266 3UTR 100% 10.800 7.560 N CAMK2A n/a
5 TRCN0000194796 CGTAAATGGATTTCGCGTTAA pLKO.1 2592 3UTR 100% 10.800 7.560 N CAMK2A n/a
6 TRCN0000010286 GACCATTAACCCATCCAAACG pLKO.1 1090 CDS 100% 4.050 2.835 N CAMK2A n/a
7 TRCN0000197215 GCCAAGGATCTGATCAATAAG pLKO.1 1064 CDS 100% 13.200 7.920 N CAMK2A n/a
8 TRCN0000194685 CAGGATTTCATCTCACCATAT pLKO.1 2994 3UTR 100% 10.800 6.480 N CAMK2A n/a
9 TRCN0000199562 CCCAACATCGTCCGACTACAT pLKO.1 542 CDS 100% 4.950 2.970 N CAMK2A n/a
10 TRCN0000360322 AGTCAGCCTGCATCGCCTATA pLKO_005 1608 CDS 100% 10.800 7.560 N Camk2a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001363990.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489162 ACTTTTCATACCCTAGATACCCAC pLX_317 21.2% 99.9% 100% V5 (not translated due to prior stop codon) 1377T>C n/a
2 TRCN0000489374 GACATACGTTCGACTGTGGTTCTC pLX_317 23.3% 99.8% 99.7% V5 1377T>C;1434_1435insG n/a
3 ccsbBroadEn_14562 pDONR223 100% 99.7% 47.9% None (many diffs) n/a
4 ccsbBroad304_14562 pLX_304 0% 99.7% 47.9% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000474396 TAATTGTTATTCACCCAAGAGACT pLX_317 23.8% 99.7% 47.9% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000491914 CGTACTATCAGCCACAACAGATGG pLX_317 31.3% 99.7% 99.7% V5 (not translated due to prior stop codon) (many diffs) n/a
7 ccsbBroadEn_14563 pDONR223 93.6% 76.2% 81.1% None (many diffs) n/a
8 ccsbBroad304_14563 pLX_304 0% 76.2% 81.1% V5 (many diffs) n/a
9 TRCN0000468031 AGCATTTCATGGTGGACCTTTAGT pLX_317 28.9% 73.6% 77.9% V5 (not translated due to frame shift) (many diffs) n/a
10 ccsbBroadEn_14564 pDONR223 0% 76.2% 81.1% None (many diffs) n/a
11 ccsbBroad304_14564 pLX_304 0% 76.2% 81.1% V5 (many diffs) n/a
12 TRCN0000480225 GACAGTGGGGGTGATCTCGGAGCG pLX_317 22.3% 76.2% 81.1% V5 (many diffs) n/a
13 TRCN0000488486 GACCTCCTCAAGAGGCAACGCTGC pLX_317 10.9% 71.1% 75.5% V5 (not translated due to prior stop codon) (many diffs) n/a
14 TRCN0000489411 AAGTGGCATAGCCCCCTCAAGCTG pLX_317 20.6% 71.1% 75.3% V5 (many diffs) n/a
Download CSV