Transcript: Mouse XM_011242710.1

PREDICTED: Mus musculus casein kinase 1, gamma 1 (Csnk1g1), transcript variant X10, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Csnk1g1 (214897)
Length:
7186
CDS:
534..1802

Additional Resources:

NCBI RefSeq record:
XM_011242710.1
NBCI Gene record:
Csnk1g1 (214897)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011242710.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000010609 GATGGCAACCTACCTTCGATA pLKO.1 1388 CDS 100% 4.950 6.930 N CSNK1G1 n/a
2 TRCN0000023800 CCTTCGATATGTCAGGCGATT pLKO.1 1400 CDS 100% 4.050 5.670 N Csnk1g1 n/a
3 TRCN0000276719 CCTTCGATATGTCAGGCGATT pLKO_005 1400 CDS 100% 4.050 5.670 N Csnk1g1 n/a
4 TRCN0000196493 GCATATTGTGTCTGGTTATAT pLKO.1 2608 3UTR 100% 15.000 10.500 N CSNK1G1 n/a
5 TRCN0000276655 CTCAACCCTCTCCAGCATAAA pLKO_005 2158 3UTR 100% 13.200 9.240 N Csnk1g1 n/a
6 TRCN0000276658 GGACTCAAGGCTGATACATTA pLKO_005 1290 CDS 100% 13.200 9.240 N Csnk1g1 n/a
7 TRCN0000276720 TACTTTGAAGACGGTGTTAAT pLKO_005 941 CDS 100% 13.200 9.240 N Csnk1g1 n/a
8 TRCN0000023801 CCAATGAATATGTAGCCATTA pLKO.1 730 CDS 100% 10.800 7.560 N Csnk1g1 n/a
9 TRCN0000023799 GCCATTAAACTGGAACCAATA pLKO.1 744 CDS 100% 10.800 7.560 N Csnk1g1 n/a
10 TRCN0000023802 CCTAGCTTGGAAGACTTGTTT pLKO.1 900 CDS 100% 5.625 3.938 N Csnk1g1 n/a
11 TRCN0000276717 CCTAGCTTGGAAGACTTGTTT pLKO_005 900 CDS 100% 5.625 3.938 N Csnk1g1 n/a
12 TRCN0000023803 CATCACAACAACAGCCTCTTA pLKO.1 1612 CDS 100% 4.950 3.465 N Csnk1g1 n/a
13 TRCN0000010607 CCTTTGACTATGCCTATGATT pLKO.1 1495 CDS 100% 5.625 3.375 N CSNK1G1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011242710.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03398 pDONR223 100% 93.6% 97.6% None (many diffs) n/a
2 ccsbBroad304_03398 pLX_304 0% 93.6% 97.6% V5 (many diffs) n/a
3 TRCN0000491660 CTATAGACTCCTGTTCTGCAACTT pLX_317 31.7% 93.6% 97.6% V5 (many diffs) n/a
4 TRCN0000488064 TTCGGGGAGCAGCTCCGAAACTCT pLX_317 27.1% 85.4% 85.5% V5 (many diffs) n/a
5 TRCN0000488866 ATGTACATGCCGCGAATCAACAAC pLX_317 27.8% 85.3% 85.5% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000489732 TAATGTCAATGTAAAACACCATGT pLX_317 37.4% 76.3% 51.4% V5 (not translated due to prior stop codon) (many diffs) n/a
7 ccsbBroadEn_15079 pDONR223 0% 68.2% 72.2% None (many diffs) n/a
8 ccsbBroad304_15079 pLX_304 0% 68.2% 72.2% V5 (many diffs) n/a
9 TRCN0000479811 TTGCCCCCTAACCCCGCCATAGCT pLX_317 43.4% 68.2% 72.2% V5 (many diffs) n/a
10 ccsbBroadEn_14160 pDONR223 100% 68.1% 72% None (many diffs) n/a
11 ccsbBroad304_14160 pLX_304 0% 68.1% 72% V5 (many diffs) n/a
12 TRCN0000472649 GAGTTCCTTCAATCACTAGGGTAA pLX_317 40.3% 68.1% 72% V5 (many diffs) n/a
Download CSV