Transcript: Human XM_011544014.2

PREDICTED: Homo sapiens AKT serine/threonine kinase 3 (AKT3), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AKT3 (10000)
Length:
4456
CDS:
211..960

Additional Resources:

NCBI RefSeq record:
XM_011544014.2
NBCI Gene record:
AKT3 (10000)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011544014.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196520 GAACAACTGTTGGGATATATA pLKO.1 1540 3UTR 100% 15.000 10.500 N AKT3 n/a
2 TRCN0000054727 CAGCTCAGACTATTACAATAA pLKO.1 839 CDS 100% 13.200 9.240 N Akt3 n/a
3 TRCN0000039889 CCAGAGGTGTTAGAAGATAAT pLKO.1 463 CDS 100% 13.200 9.240 N AKT3 n/a
4 TRCN0000195437 CTCTGCAAGTGGACGAGAATA pLKO.1 939 CDS 100% 13.200 9.240 N AKT3 n/a
5 TRCN0000039892 CTGAGACAGATACTAGATATT pLKO.1 803 CDS 100% 13.200 9.240 N AKT3 n/a
6 TRCN0000195243 CTTGGGATCATGGTACATTTA pLKO.1 2434 3UTR 100% 13.200 9.240 N AKT3 n/a
7 TRCN0000374318 GCTACTGTCTTACTATTATAG pLKO_005 1199 3UTR 100% 13.200 9.240 N Akt3 n/a
8 TRCN0000001612 GCTGCTACTGTCTTACTATTA pLKO.1 1196 3UTR 100% 13.200 9.240 N AKT3 n/a
9 TRCN0000010184 GTAAACTGGCAAGATGTATAT pLKO.1 742 CDS 100% 13.200 9.240 N AKT3 n/a
10 TRCN0000001614 ACTGGCAAGATGTATATGATA pLKO.1 746 CDS 100% 5.625 3.938 N AKT3 n/a
11 TRCN0000010181 GAAATGATGTGTGGGAGGTTA pLKO.1 532 CDS 100% 4.950 3.465 N AKT3 n/a
12 TRCN0000055437 GAAATGATGTGTGGGAGGTTA pLKO.1 532 CDS 100% 4.950 3.465 N AKT3 n/a
13 TRCN0000022835 GCTCTTGATAAAGGATCCAAA pLKO.1 657 CDS 100% 4.950 3.465 N Akt3 n/a
14 TRCN0000196481 GACATTAAATTTCCTCGAACA pLKO.1 604 CDS 100% 4.050 2.835 N AKT3 n/a
15 TRCN0000010292 CATTCTGCTACTTCACTGTCA pLKO.1 969 3UTR 100% 2.640 1.848 N AKT3 n/a
16 TRCN0000039888 CCTCATCTTTCTCCTTCATTA pLKO.1 2581 3UTR 100% 13.200 7.920 N AKT3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011544014.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489678 TCCTTCGGCAATATGTCCCTGACC pLX_317 26.8% 50.2% 42.1% V5 (many diffs) n/a
2 TRCN0000489669 GCGGGCGGAAGTCATGTGCGCTCC pLX_317 28.3% 50.2% 42.1% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000487677 GGAGAAATTATCCTCAACCATTAC pLX_317 9% 50.2% 42.1% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_14950 pDONR223 100% 50% 44.6% None (many diffs) n/a
5 ccsbBroad304_14950 pLX_304 35.9% 50% 44.6% V5 (many diffs) n/a
6 TRCN0000470264 CTGCTGTTGCGGCCGTAACAACGT pLX_317 19.2% 50% 44.6% V5 (many diffs) n/a
7 ccsbBroadEn_07529 pDONR223 100% 46% 36.5% None (many diffs) n/a
8 ccsbBroad304_07529 pLX_304 45.1% 46% 36.5% V5 (many diffs) n/a
9 TRCN0000473926 TGTAACGCGCAGGATGTGGCCCAG pLX_317 34.7% 46% 36.5% V5 (many diffs) n/a
Download CSV