Transcript: Human XM_011545353.3

PREDICTED: Homo sapiens integrator complex subunit 4 (INTS4), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
INTS4 (92105)
Length:
1814
CDS:
25..1560

Additional Resources:

NCBI RefSeq record:
XM_011545353.3
NBCI Gene record:
INTS4 (92105)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011545353.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000127891 CATCTGACAGATACGTCTCAT pLKO.1 496 CDS 100% 4.950 6.930 N INTS4 n/a
2 TRCN0000425326 TGTCAGAACAGCAGCTATAAA pLKO_005 654 CDS 100% 15.000 10.500 N INTS4 n/a
3 TRCN0000416514 CAAGCTATCCAAATGCGATTA pLKO_005 457 CDS 100% 10.800 7.560 N INTS4 n/a
4 TRCN0000424098 GCTCAACTGCTGGATACTTTG pLKO_005 406 CDS 100% 10.800 7.560 N INTS4 n/a
5 TRCN0000426966 TACTAAGAAACTCCGACTAAC pLKO_005 96 CDS 100% 10.800 7.560 N INTS4 n/a
6 TRCN0000131114 GCTCCATGAAAGAGGACTGAA pLKO.1 687 CDS 100% 4.950 3.465 N INTS4 n/a
7 TRCN0000134641 GTCCCAATTCCTTCTTCTAAT pLKO.1 826 CDS 100% 13.200 6.600 Y INTS4P1 n/a
8 TRCN0000017460 GAGATGTATGAGGTTCGTATT pLKO.1 1180 CDS 100% 10.800 5.400 Y LOC402530 n/a
9 TRCN0000134429 GAGATGTATGAGGTTCGTATT pLKO.1 1180 CDS 100% 10.800 5.400 Y INTS4P1 n/a
10 TRCN0000016523 GCAAGTCAGTTCTCATTTCTT pLKO.1 954 CDS 100% 5.625 2.813 Y LOC401361 n/a
11 TRCN0000129887 GCAAGTCAGTTCTCATTTCTT pLKO.1 954 CDS 100% 5.625 2.813 Y INTS4 n/a
12 TRCN0000016526 CCTACTGATAGGGACTCCATA pLKO.1 1513 CDS 100% 4.950 2.475 Y LOC401361 n/a
13 TRCN0000017462 CCTTGATTTCCTAGTTGACAT pLKO.1 1260 CDS 100% 4.950 2.475 Y LOC402530 n/a
14 TRCN0000128560 GCCTGTAAATTACTCTCTGAT pLKO.1 733 CDS 100% 4.950 2.475 Y INTS4 n/a
15 TRCN0000016525 GCTCCCAAGGAAGAAGTAGAT pLKO.1 1096 CDS 100% 4.950 2.475 Y LOC401361 n/a
16 TRCN0000128108 CGCTTAGTTGATGATGCGTTT pLKO.1 856 CDS 100% 4.050 2.025 Y INTS4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011545353.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12974 pDONR223 100% 98.7% 98.8% None 1515_1533delinsG n/a
2 ccsbBroad304_12974 pLX_304 0% 98.7% 98.8% V5 1515_1533delinsG n/a
3 TRCN0000470961 GAATTATTCATAGACCCCCAATAG pLX_317 30.1% 98.7% 98.8% V5 1515_1533delinsG n/a
4 ccsbBroadEn_12975 pDONR223 100% 54.9% 53.3% None (many diffs) n/a
5 ccsbBroad304_12975 pLX_304 0% 54.9% 53.3% V5 (many diffs) n/a
6 TRCN0000491572 TCTTGCAAAAGGGGAGCATACACC pLX_317 25% 54.9% 53.3% V5 (many diffs) n/a
7 ccsbBroadEn_13723 pDONR223 100% 42.2% 38% None (many diffs) n/a
8 ccsbBroad304_13723 pLX_304 0% 42.2% 38% V5 (many diffs) n/a
9 TRCN0000469026 TTGCGCAAGTTGCCCGAAACCAAC pLX_317 32.2% 42.2% 38% V5 (many diffs) n/a
Download CSV