Transcript: Human XM_024451520.1

PREDICTED: Homo sapiens zinc finger protein 724 (ZNF724), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF724 (440519)
Length:
2748
CDS:
280..1947

Additional Resources:

NCBI RefSeq record:
XM_024451520.1
NBCI Gene record:
ZNF724 (440519)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024451520.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236731 ACCTTACTACACATAAGATAA pLKO_005 890 CDS 100% 13.200 6.600 Y ZNF98 n/a
2 TRCN0000344452 CCCTTACTAGACATAAGATAA pLKO_005 974 CDS 100% 13.200 6.600 Y ZNF737 n/a
3 TRCN0000225755 CCGGAGAGAAACCCTACAAAT pLKO_005 1337 CDS 100% 13.200 6.600 Y Zfp808 n/a
4 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 1421 CDS 100% 13.200 6.600 Y Zfp934 n/a
5 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 1421 CDS 100% 13.200 6.600 Y 2810408B13Rik n/a
6 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 1421 CDS 100% 13.200 6.600 Y EG668616 n/a
7 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 1975 3UTR 100% 4.950 2.475 Y CFLAR n/a
8 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 1975 3UTR 100% 4.950 2.475 Y C19orf31 n/a
9 TRCN0000107758 TGTCTCTAAGCCAGACCTGAT pLKO.1 225 5UTR 100% 4.050 2.025 Y ZNF273 n/a
10 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 1973 3UTR 100% 4.950 2.475 Y ERN2 n/a
11 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 1973 3UTR 100% 4.950 2.475 Y P3H4 n/a
12 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 1973 3UTR 100% 4.950 2.475 Y P3H4 n/a
13 TRCN0000158848 GAGAAACCTTACAAATGTGAT pLKO.1 1174 CDS 100% 4.950 2.475 Y ZNF28 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024451520.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11232 pDONR223 100% 78.4% 67.7% None (many diffs) n/a
2 ccsbBroad304_11232 pLX_304 0% 78.4% 67.7% V5 (many diffs) n/a
3 TRCN0000476048 TACTATCCCAATAGAAACACCTCC pLX_317 21.8% 78.4% 67.7% V5 (many diffs) n/a
4 ccsbBroadEn_09655 pDONR223 100% 71.6% 61.6% None (many diffs) n/a
5 ccsbBroad304_09655 pLX_304 0% 71.6% 61.6% V5 (many diffs) n/a
6 TRCN0000468487 GAACACCAGATCGGTGGCCCTCAA pLX_317 20.1% 71.6% 61.6% V5 (many diffs) n/a
7 ccsbBroadEn_13028 pDONR223 100% 70.6% 61.8% None (many diffs) n/a
8 ccsbBroad304_13028 pLX_304 0% 70.6% 61.8% V5 (many diffs) n/a
9 TRCN0000468257 GTACACCAGACCACTACATGCGAC pLX_317 25.6% 70.6% 61.8% V5 (many diffs) n/a
10 ccsbBroadEn_09784 pDONR223 100% 63.7% 54.2% None (many diffs) n/a
11 ccsbBroad304_09784 pLX_304 0% 63.7% 54.2% V5 (many diffs) n/a
12 TRCN0000478115 ATTTTTATATATACCACTCGGCCC pLX_317 19.7% 63.7% 54.2% V5 (many diffs) n/a
13 ccsbBroadEn_15167 pDONR223 53.6% 61.6% 19.7% None (many diffs) n/a
14 ccsbBroad304_15167 pLX_304 0% 61.6% 19.7% V5 (not translated due to prior stop codon) (many diffs) n/a
15 TRCN0000477054 GAGCCAATTTATTAAACTTAACTA pLX_317 14.1% 60.9% 52.9% V5 (many diffs) n/a
16 ccsbBroadEn_15067 pDONR223 92.3% 60.9% 53.2% None (many diffs) n/a
17 ccsbBroad304_15067 pLX_304 0% 60.9% 53.2% V5 (not translated due to prior stop codon) (many diffs) n/a
18 ccsbBroadEn_07157 pDONR223 100% 59.3% 51.7% None (many diffs) n/a
19 ccsbBroad304_07157 pLX_304 0% 59.3% 51.7% V5 (many diffs) n/a
20 TRCN0000475452 TAAAACTTCAACTTGGTTTCCTTC pLX_317 10.2% 59.3% 51.7% V5 (many diffs) n/a
Download CSV