Transcript: Human XR_001748039.2

PREDICTED: Homo sapiens integrator complex subunit 4 (INTS4), transcript variant X7, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
INTS4 (92105)
Length:
3286
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001748039.2
NBCI Gene record:
INTS4 (92105)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001748039.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000127891 CATCTGACAGATACGTCTCAT pLKO.1 496 3UTR 100% 4.950 6.930 N INTS4 n/a
2 TRCN0000442225 CCGGCTCATCACTCAGGTTTA pLKO_005 2877 3UTR 100% 10.800 8.640 N INTS4 n/a
3 TRCN0000425326 TGTCAGAACAGCAGCTATAAA pLKO_005 654 3UTR 100% 15.000 10.500 N INTS4 n/a
4 TRCN0000416514 CAAGCTATCCAAATGCGATTA pLKO_005 457 3UTR 100% 10.800 7.560 N INTS4 n/a
5 TRCN0000424098 GCTCAACTGCTGGATACTTTG pLKO_005 406 3UTR 100% 10.800 7.560 N INTS4 n/a
6 TRCN0000426966 TACTAAGAAACTCCGACTAAC pLKO_005 96 3UTR 100% 10.800 7.560 N INTS4 n/a
7 TRCN0000427754 CTTCTTAGGTGTCAGAATGAG pLKO_005 3137 3UTR 100% 4.950 3.465 N INTS4 n/a
8 TRCN0000131114 GCTCCATGAAAGAGGACTGAA pLKO.1 687 3UTR 100% 4.950 3.465 N INTS4 n/a
9 TRCN0000414187 TGGAATTGATGTGTAGGCTTA pLKO_005 3179 3UTR 100% 4.050 2.835 N INTS4 n/a
10 TRCN0000131007 CTGTCCAACAATGCCAGCATT pLKO.1 1695 3UTR 100% 4.950 2.970 N INTS4 n/a
11 TRCN0000134641 GTCCCAATTCCTTCTTCTAAT pLKO.1 826 3UTR 100% 13.200 6.600 Y INTS4P1 n/a
12 TRCN0000017460 GAGATGTATGAGGTTCGTATT pLKO.1 1180 3UTR 100% 10.800 5.400 Y LOC402530 n/a
13 TRCN0000134429 GAGATGTATGAGGTTCGTATT pLKO.1 1180 3UTR 100% 10.800 5.400 Y INTS4P1 n/a
14 TRCN0000016523 GCAAGTCAGTTCTCATTTCTT pLKO.1 954 3UTR 100% 5.625 2.813 Y LOC401361 n/a
15 TRCN0000129887 GCAAGTCAGTTCTCATTTCTT pLKO.1 954 3UTR 100% 5.625 2.813 Y INTS4 n/a
16 TRCN0000016526 CCTACTGATAGGGACTCCATA pLKO.1 1513 3UTR 100% 4.950 2.475 Y LOC401361 n/a
17 TRCN0000016524 CCTTGAGGTTACCAGGTAGAA pLKO.1 1781 3UTR 100% 4.950 2.475 Y LOC401361 n/a
18 TRCN0000017462 CCTTGATTTCCTAGTTGACAT pLKO.1 1260 3UTR 100% 4.950 2.475 Y LOC402530 n/a
19 TRCN0000016527 CGAGACAGTCTTTCTCATCTT pLKO.1 1753 3UTR 100% 4.950 2.475 Y LOC401361 n/a
20 TRCN0000136432 CGAGACAGTCTTTCTCATCTT pLKO.1 1753 3UTR 100% 4.950 2.475 Y INTS4P1 n/a
21 TRCN0000128560 GCCTGTAAATTACTCTCTGAT pLKO.1 733 3UTR 100% 4.950 2.475 Y INTS4 n/a
22 TRCN0000016525 GCTCCCAAGGAAGAAGTAGAT pLKO.1 1096 3UTR 100% 4.950 2.475 Y LOC401361 n/a
23 TRCN0000017459 GCTGAACCAGACATGGATGAT pLKO.1 1627 3UTR 100% 4.950 2.475 Y LOC402530 n/a
24 TRCN0000129371 GCTGAACCAGACATGGATGAT pLKO.1 1627 3UTR 100% 4.950 2.475 Y INTS4 n/a
25 TRCN0000136690 GCTGAACCAGACATGGATGAT pLKO.1 1627 3UTR 100% 4.950 2.475 Y INTS4P1 n/a
26 TRCN0000128108 CGCTTAGTTGATGATGCGTTT pLKO.1 856 3UTR 100% 4.050 2.025 Y INTS4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001748039.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12975 pDONR223 100% 46.3% None (many diffs) n/a
2 ccsbBroad304_12975 pLX_304 0% 46.3% V5 (many diffs) n/a
3 TRCN0000491572 TCTTGCAAAAGGGGAGCATACACC pLX_317 25% 46.3% V5 (many diffs) n/a
4 ccsbBroadEn_12974 pDONR223 100% 46.1% None 1_24del;1540_3286del n/a
5 ccsbBroad304_12974 pLX_304 0% 46.1% V5 1_24del;1540_3286del n/a
6 TRCN0000470961 GAATTATTCATAGACCCCCAATAG pLX_317 30.1% 46.1% V5 1_24del;1540_3286del n/a
7 ccsbBroadEn_13723 pDONR223 100% 37.5% None (many diffs) n/a
8 ccsbBroad304_13723 pLX_304 0% 37.5% V5 (many diffs) n/a
9 TRCN0000469026 TTGCGCAAGTTGCCCGAAACCAAC pLX_317 32.2% 37.5% V5 (many diffs) n/a
Download CSV