Transcript: Human XR_002956446.1

PREDICTED: Homo sapiens tripartite motif containing 74 (TRIM74), transcript variant X29, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TRIM74 (378108)
Length:
4043
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002956446.1
NBCI Gene record:
TRIM74 (378108)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002956446.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000359564 ACTGATACTTATCCTTAAACT pLKO_005 569 3UTR 100% 5.625 3.375 N STAG3L1 n/a
2 TRCN0000139360 CAGCTTCTGCTGTCCTTCTTT pLKO.1 669 3UTR 100% 5.625 2.813 Y STAG3L3 n/a
3 TRCN0000062689 GCCGTCAGATTACTGATACTT pLKO.1 558 3UTR 100% 5.625 2.813 Y STAG3L1 n/a
4 TRCN0000135957 GCCGTCAGATTACTGATACTT pLKO.1 558 3UTR 100% 5.625 2.813 Y STAG3 n/a
5 TRCN0000142277 GCCGTCAGATTACTGATACTT pLKO.1 558 3UTR 100% 5.625 2.813 Y STAG3L3 n/a
6 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 3686 3UTR 100% 4.950 2.475 Y CFLAR n/a
7 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 3686 3UTR 100% 4.950 2.475 Y C19orf31 n/a
8 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 1050 3UTR 100% 4.950 2.475 Y LOC387873 n/a
9 TRCN0000172776 GCTTCAAGGACTGGATGGTTT pLKO.1 499 3UTR 100% 4.950 2.475 Y STAG3L2 n/a
10 TRCN0000140844 CAGAGGACTTTCTTCCAGCTT pLKO.1 654 3UTR 100% 2.640 1.320 Y STAG3L3 n/a
11 TRCN0000164801 CCTCCCAAAGTACTGGGATTA pLKO.1 2653 3UTR 100% 1.080 0.540 Y MAPKAPK5-AS1 n/a
12 TRCN0000142181 GTTTCCATGATCATGGACAGA pLKO.1 516 3UTR 100% 0.264 0.132 Y STAG3L3 n/a
13 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1087 3UTR 100% 5.625 2.813 Y KLHL30 n/a
14 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 3684 3UTR 100% 4.950 2.475 Y ERN2 n/a
15 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 3684 3UTR 100% 4.950 2.475 Y P3H4 n/a
16 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 3684 3UTR 100% 4.950 2.475 Y P3H4 n/a
17 TRCN0000128227 CAGGAGAATCACTTGAATCTA pLKO.1 3854 3UTR 100% 5.625 2.813 Y NLRP8 n/a
18 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1087 3UTR 100% 5.625 2.813 Y EID2B n/a
19 TRCN0000107105 CGAGGTCAGGAGTTTGAGATT pLKO.1 3732 3UTR 100% 4.950 2.475 Y NLRP12 n/a
20 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 2068 3UTR 100% 2.640 1.320 Y LINC01098 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002956446.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10171 pDONR223 100% 6.3% None (many diffs) n/a
2 ccsbBroad304_10171 pLX_304 0% 6.3% V5 (many diffs) n/a
3 TRCN0000474301 GGCATGATAACGCGACACGTACAC pLX_317 60.6% 6.3% V5 (many diffs) n/a
4 ccsbBroadEn_13704 pDONR223 100% 5.6% None (many diffs) n/a
5 ccsbBroad304_13704 pLX_304 0% 5.6% V5 (many diffs) n/a
6 ccsbBroadEn_10792 pDONR223 100% 5.3% None (many diffs) n/a
7 ccsbBroad304_10792 pLX_304 0% 5.3% V5 (many diffs) n/a
8 TRCN0000472287 GCCTGGAGAGCTTTCCTCGTCACG pLX_317 100% 5.3% V5 (many diffs) n/a
9 ccsbBroadEn_10619 pDONR223 92.9% 4.9% None (many diffs) n/a
10 ccsbBroad304_10619 pLX_304 0% 4.9% V5 (many diffs) n/a
Download CSV