Transcript: Human NM_001025105.3

Homo sapiens casein kinase 1 alpha 1 (CSNK1A1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
CSNK1A1 (1452)
Length:
5444
CDS:
476..1573

Additional Resources:

NCBI RefSeq record:
NM_001025105.3
NBCI Gene record:
CSNK1A1 (1452)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001149315 CCGGGTTCTTACCGTATGTG pXPR_003 GGG 225 20% 2 0.2312 CSNK1A1 CSNK1A1 76188
2 BRDN0001145896 CGCCAAATAGATGTCCCCGA pXPR_003 AGG 85 8% 1 0.1158 CSNK1A1 CSNK1A1 76190
3 BRDN0001145680 TTGCTCTCGTACAGCAACTG pXPR_003 GGG 168 15% 2 -0.0086 CSNK1A1 CSNK1A1 76189
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001025105.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220643 CATCTATTTGGCGATCAACAT pLKO.1 565 CDS 100% 4.950 6.930 N CSNK1A1 n/a
2 TRCN0000342505 CATCTATTTGGCGATCAACAT pLKO_005 565 CDS 100% 4.950 6.930 N CSNK1A1 n/a
3 TRCN0000196287 GCAAGCTCTATAAGATTCTTC pLKO.1 657 CDS 100% 4.950 6.930 N CSNK1A1 n/a
4 TRCN0000342454 GCAAGCTCTATAAGATTCTTC pLKO_005 657 CDS 100% 4.950 6.930 N CSNK1A1 n/a
5 TRCN0000194651 CCTTGCTGACTCACTATTAAA pLKO.1 2476 3UTR 100% 15.000 10.500 N CSNK1A1 n/a
6 TRCN0000199766 GACTAGCAGCTGGACTGATTT pLKO.1 2748 3UTR 100% 13.200 9.240 N CSNK1A1 n/a
7 TRCN0000196743 GCATCTAAAGTGAAGACTTAA pLKO.1 2176 3UTR 100% 13.200 9.240 N CSNK1A1 n/a
8 TRCN0000199260 CCCGATATGCTAGCATCAATG pLKO.1 1113 CDS 100% 10.800 7.560 N CSNK1A1 n/a
9 TRCN0000220641 GCAGAATTTGCGATGTACTTA pLKO.1 1319 CDS 100% 5.625 3.938 N CSNK1A1 n/a
10 TRCN0000342507 GCAGAATTTGCGATGTACTTA pLKO_005 1319 CDS 100% 5.625 3.938 N CSNK1A1 n/a
11 TRCN0000220642 CAAGAGTAACATGAAAGGTTT pLKO.1 1549 CDS 100% 4.950 3.465 N CSNK1A1 n/a
12 TRCN0000199710 GCCACAGTTGTGATGGTTGTT pLKO.1 1973 3UTR 100% 4.950 3.465 N CSNK1A1 n/a
13 TRCN0000342508 GCCACAGTTGTGATGGTTGTT pLKO_005 1973 3UTR 100% 4.950 3.465 N CSNK1A1 n/a
14 TRCN0000010990 GCCTGCTTAATTGTGCTAGAA pLKO.1 2149 3UTR 100% 4.950 3.465 N CSNK1A1 n/a
15 TRCN0000196790 GATAACTTCCTAATGGGTATT pLKO.1 893 CDS 100% 10.800 6.480 N CSNK1A1 n/a
16 TRCN0000220644 GAATTCATTGTCGGAGGGAAA pLKO.1 503 CDS 100% 0.000 0.000 N CSNK1A1 n/a
17 TRCN0000196509 GACTACAATGTACTAGTCATG pLKO.1 725 CDS 100% 0.000 0.000 N CSNK1A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001025105.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489949 GCATCGCACCCAACTGGGATACTC pLX_317 39.7% 92.2% 92% V5 455_538del;1095_1096insG n/a
2 ccsbBroadEn_06055 pDONR223 100% 92.2% 92% None 455_538del;775C>A n/a
3 ccsbBroad304_06055 pLX_304 66.4% 92.2% 92% V5 455_538del;775C>A n/a
4 TRCN0000477459 AATTTCCATTAGTCTTCCTTATAA pLX_317 42.5% 92.2% 92% V5 455_538del;775C>A n/a
5 TRCN0000488414 CCCTCATTAATCGTGTGGTTAAAT pLX_317 34.4% 92.2% 92% V5 (not translated due to prior stop codon) 455_538del;1072A>T n/a
6 TRCN0000492345 TCCACGATCACCACTAATTCCGCC pLX_317 46% 92.2% 92% V5 (not translated due to prior stop codon) 455_538del;934C>T n/a
7 TRCN0000489092 CTTCAAACAGAGGGAACCCCTATC pLX_317 35.2% 92.1% 91.8% V5 455_538del;934C>T;1095_1096insG n/a
8 ccsbBroad304_14599 pLX_304 66.1% 91.8% 20.8% V5 (not translated due to prior stop codon) 226_226delAinsCAN;229_230delCGinsNN;455_538del n/a
9 TRCN0000473547 CTCATCCGGTGCGATGATGCCAAA pLX_317 42.4% 91.8% 20.8% V5 (not translated due to prior stop codon) (many diffs) n/a
10 ccsbBroadEn_14599 pDONR223 100% 91.4% 20.8% None (many diffs) n/a
11 ccsbBroadEn_09471 pDONR223 100% 84.6% 84.1% None (many diffs) n/a
12 ccsbBroad304_09471 pLX_304 0% 84.6% 84.1% V5 (many diffs) n/a
13 TRCN0000479467 AACCGTGTACGGGCCCCCAACCGA pLX_317 39.4% 84.6% 84.1% V5 (many diffs) n/a
14 ccsbBroadEn_15232 pDONR223 0% 84.6% 84.1% None (many diffs) n/a
15 ccsbBroad304_15232 pLX_304 0% 84.6% 84.1% V5 (many diffs) n/a
16 TRCN0000479515 GTCTGAATTAGTTATATTGCCGTG pLX_317 36.9% 84.6% 84.1% V5 (many diffs) n/a
17 TRCN0000488459 AGGGTACAACTCATGCCAATTGTA pLX_317 28.3% 84.6% 84.1% V5 (not translated due to prior stop codon) (many diffs) n/a
18 TRCN0000489911 TACCACATCGATAAACGCTCGCAG pLX_317 34.5% 84.5% 83.8% V5 (many diffs) n/a
Download CSV